Transcript: Mouse XM_017318302.1

PREDICTED: Mus musculus RAB3A interacting protein (rabin3)-like 1 (Rab3il1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3il1 (74760)
Length:
2622
CDS:
975..1700

Additional Resources:

NCBI RefSeq record:
XM_017318302.1
NBCI Gene record:
Rab3il1 (74760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110148 CTTCTTCACCTATATTCGCTA pLKO.1 1568 CDS 100% 2.640 3.696 N Rab3il1 n/a
2 TRCN0000110146 GCCCACTGTTGAGTGTAACAA pLKO.1 1424 CDS 100% 5.625 4.500 N Rab3il1 n/a
3 TRCN0000140658 CCTGTTTGAGGAAGCTCACAA pLKO.1 1121 CDS 100% 4.950 3.465 N RAB3IL1 n/a
4 TRCN0000110149 GAGCTGAAGCTAAAGGATGAA pLKO.1 1035 CDS 100% 4.950 3.465 N Rab3il1 n/a
5 TRCN0000110147 GTATGCAACTTCTTCACCTAT pLKO.1 1560 CDS 100% 4.950 3.465 N Rab3il1 n/a
6 TRCN0000140631 GAGGAAGCTCACAAGATGGTT pLKO.1 1128 CDS 100% 3.000 1.500 Y RAB3IL1 n/a
7 TRCN0000140875 GTTCTGGGAGATCATGAGGTT pLKO.1 1628 CDS 100% 2.640 1.848 N RAB3IL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15558 pDONR223 0% 58.7% 61.5% None (many diffs) n/a
2 ccsbBroad304_15558 pLX_304 0% 58.7% 61.5% V5 (many diffs) n/a
3 ccsbBroadEn_01359 pDONR223 100% 54.7% 57.3% None (many diffs) n/a
4 ccsbBroad304_01359 pLX_304 0% 54.7% 57.3% V5 (many diffs) n/a
5 TRCN0000475494 CCCCTAGTCAGCCACCACAGAATC pLX_317 43.6% 54.6% 24.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV