Transcript: Mouse XM_017318416.1

PREDICTED: Mus musculus X-linked myotubular myopathy gene 1 (Mtm1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtm1 (17772)
Length:
3549
CDS:
546..1949

Additional Resources:

NCBI RefSeq record:
XM_017318416.1
NBCI Gene record:
Mtm1 (17772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348907 GGCCTTGCGTGACGATTATAT pLKO_005 1820 CDS 100% 15.000 21.000 N Mtm1 n/a
2 TRCN0000306032 TGGCCTTGCGTGACGATTATA pLKO_005 1819 CDS 100% 15.000 21.000 N Mtm1 n/a
3 TRCN0000080723 CCTCTAGTCAATTCGCCTTAT pLKO.1 2759 3UTR 100% 10.800 15.120 N Mtm1 n/a
4 TRCN0000325679 CCTCTAGTCAATTCGCCTTAT pLKO_005 2759 3UTR 100% 10.800 15.120 N Mtm1 n/a
5 TRCN0000348844 TTGGAGAATGAATCCATTAAG pLKO_005 122 5UTR 100% 13.200 10.560 N Mtm1 n/a
6 TRCN0000080726 GCACACAATCTGCCATTATTT pLKO.1 515 5UTR 100% 15.000 10.500 N Mtm1 n/a
7 TRCN0000325680 GCACACAATCTGCCATTATTT pLKO_005 515 5UTR 100% 15.000 10.500 N Mtm1 n/a
8 TRCN0000348908 TTGGAACTGTGGGTGAATTAT pLKO_005 1728 CDS 100% 15.000 10.500 N Mtm1 n/a
9 TRCN0000331439 CATCACAAATTATCGTCTTTA pLKO_005 274 5UTR 100% 13.200 9.240 N Mtm1 n/a
10 TRCN0000355882 CATCACAAATTATCGTCTTTA pLKO_005 274 5UTR 100% 13.200 9.240 N MTM1 n/a
11 TRCN0000080724 CCCAACATAGAAGAATCTCAT pLKO.1 1125 CDS 100% 4.950 3.465 N Mtm1 n/a
12 TRCN0000080727 CTTTGAGATATTGGTACAGAA pLKO.1 1343 CDS 100% 4.950 3.465 N Mtm1 n/a
13 TRCN0000325678 CTTTGAGATATTGGTACAGAA pLKO_005 1343 CDS 100% 4.950 3.465 N Mtm1 n/a
14 TRCN0000080725 GCCATAAATTTGCATCTAGAA pLKO.1 1381 CDS 100% 4.950 3.465 N Mtm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06602 pDONR223 100% 63.8% 65.9% None (many diffs) n/a
2 ccsbBroad304_06602 pLX_304 0% 63.8% 65.9% V5 (many diffs) n/a
3 TRCN0000473224 TACAGGCAATACACCTGTCCTGGT pLX_317 28.9% 63.8% 65.9% V5 (many diffs) n/a
4 TRCN0000488963 AACAAACATTACAGCATACCTACG pLX_317 19.6% 63.8% 65.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV