Transcript: Mouse XM_017319079.1

PREDICTED: Mus musculus cDNA sequence BC052040 (BC052040), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
BC052040 (399568)
Length:
2971
CDS:
276..1316

Additional Resources:

NCBI RefSeq record:
XM_017319079.1
NBCI Gene record:
BC052040 (399568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195940 CCACCCTCCAAGTCTGTTATA pLKO.1 579 CDS 100% 13.200 10.560 N BC052040 n/a
2 TRCN0000183290 GCAGCTATCATTATGAGATTT pLKO.1 2087 3UTR 100% 13.200 9.240 N BC052040 n/a
3 TRCN0000376573 TCATCTATTGGTATGGATTTA pLKO_005 1116 CDS 100% 13.200 9.240 N C15orf41 n/a
4 TRCN0000167474 GTCATCTATTGGTATGGATTT pLKO.1 1115 CDS 100% 10.800 7.560 N C15orf41 n/a
5 TRCN0000184719 CCGCTACTACATTGCCTGTAT pLKO.1 2725 3UTR 100% 4.950 3.465 N BC052040 n/a
6 TRCN0000180902 GAGAGACTTGCTTCTGAAGAA pLKO.1 743 CDS 100% 4.950 3.465 N BC052040 n/a
7 TRCN0000180399 GTTCTAGCAAACCAGGTCTAT pLKO.1 639 CDS 100% 4.950 3.465 N BC052040 n/a
8 TRCN0000370260 CCAGATGGAGTTCTAGCAAAT pLKO_005 630 CDS 100% 10.800 7.560 N C15orf41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04397 pDONR223 100% 48% 38.9% None (many diffs) n/a
2 ccsbBroad304_04397 pLX_304 0% 48% 38.9% V5 (many diffs) n/a
3 TRCN0000468087 TTTTTATCTTACACCTCATACCGT pLX_317 82.7% 48% 38.9% V5 (many diffs) n/a
Download CSV