Transcript: Mouse XM_017319150.1

PREDICTED: Mus musculus Sec61, alpha subunit 2 (S. cerevisiae) (Sec61a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec61a2 (57743)
Length:
2507
CDS:
671..1654

Additional Resources:

NCBI RefSeq record:
XM_017319150.1
NBCI Gene record:
Sec61a2 (57743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305434 AGGTACTATGGACTGCTATAA pLKO_005 207 5UTR 100% 13.200 18.480 N Sec61a2 n/a
2 TRCN0000111644 CGTGGATAGAAGTTTCTGGTT pLKO.1 1356 CDS 100% 2.640 3.696 N Sec61a2 n/a
3 TRCN0000111641 GCTCTTCTACACGTCGAATAT pLKO.1 1069 CDS 100% 13.200 10.560 N Sec61a2 n/a
4 TRCN0000309924 GCTCTTCTACACGTCGAATAT pLKO_005 1069 CDS 100% 13.200 10.560 N Sec61a2 n/a
5 TRCN0000166254 CCAGATGCTGTCTGTTCGATT pLKO.1 1138 CDS 100% 4.950 3.960 N SEC61A2 n/a
6 TRCN0000343072 CCAGATGCTGTCTGTTCGATT pLKO_005 1138 CDS 100% 4.950 3.960 N SEC61A2 n/a
7 TRCN0000111643 CCCAATTGTAACGTCTGGTTT pLKO.1 361 5UTR 100% 4.950 3.960 N Sec61a2 n/a
8 TRCN0000111640 CCTAATGAGTTATGGAGCATT pLKO.1 2032 3UTR 100% 4.950 3.960 N Sec61a2 n/a
9 TRCN0000305488 CATACTGTTTCTGTCAAATAA pLKO_005 1700 3UTR 100% 15.000 10.500 N Sec61a2 n/a
10 TRCN0000311326 GAGTCTATGGGAGCCATATTT pLKO_005 1268 CDS 100% 15.000 10.500 N Sec61a2 n/a
11 TRCN0000111642 CCTGTTCATGTAGTTGTATAT pLKO.1 1295 CDS 100% 13.200 9.240 N Sec61a2 n/a
12 TRCN0000309861 CCTGTTCATGTAGTTGTATAT pLKO_005 1295 CDS 100% 13.200 9.240 N Sec61a2 n/a
13 TRCN0000164803 CTGCTGTTAGATGAGCTGCTA pLKO.1 710 CDS 100% 2.640 1.848 N SEC61A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12176 pDONR223 100% 50.1% 55% None (many diffs) n/a
2 ccsbBroad304_12176 pLX_304 0% 50.1% 55% V5 (many diffs) n/a
3 TRCN0000465248 CTGCCAGGTTTGACATAATTAATT pLX_317 30.6% 50.1% 55% V5 (many diffs) n/a
Download CSV