Transcript: Mouse XM_017319248.1

PREDICTED: Mus musculus alkB homolog 3, alpha-ketoglutarate-dependent dioxygenase (Alkbh3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Alkbh3 (69113)
Length:
1055
CDS:
288..794

Additional Resources:

NCBI RefSeq record:
XM_017319248.1
NBCI Gene record:
Alkbh3 (69113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251539 TGTCTAGGGTGTGCTTATATC pLKO_005 193 5UTR 100% 13.200 18.480 N Alkbh3 n/a
2 TRCN0000251537 CTCCAGACAACCGAGAGTAAA pLKO_005 725 CDS 100% 13.200 9.240 N Alkbh3 n/a
3 TRCN0000251536 GTTCAGAAAGCGTGGTGTTTG pLKO_005 880 3UTR 100% 10.800 7.560 N Alkbh3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16129 pDONR223 0% 71.4% 76.7% None (many diffs) n/a
2 ccsbBroad304_16129 pLX_304 0% 71.4% 76.7% V5 (many diffs) n/a
3 TRCN0000470655 AATGAGGATATGAGTTTAGCAGAA pLX_317 100% 71.4% 76.7% V5 (many diffs) n/a
4 ccsbBroadEn_09866 pDONR223 100% 51.3% 53.8% None (many diffs) n/a
5 ccsbBroad304_09866 pLX_304 0% 51.3% 53.8% V5 (many diffs) n/a
6 TRCN0000468018 AGAGCCGGGGCCCACTGATTTCCG pLX_317 49.1% 51.3% 53.8% V5 (many diffs) n/a
Download CSV