Transcript: Mouse XM_017319956.1

PREDICTED: Mus musculus epidermal growth factor receptor pathway substrate 15 (Eps15), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eps15 (13858)
Length:
5019
CDS:
156..2531

Additional Resources:

NCBI RefSeq record:
XM_017319956.1
NBCI Gene record:
Eps15 (13858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111721 GCAGTAATACATCGGTAGAAA pLKO.1 2197 CDS 100% 5.625 7.875 N Eps15 n/a
2 TRCN0000316297 GCAGTAATACATCGGTAGAAA pLKO_005 2197 CDS 100% 5.625 7.875 N Eps15 n/a
3 TRCN0000111720 CCTATGAGCATGGGATACAAA pLKO.1 2742 3UTR 100% 5.625 3.938 N Eps15 n/a
4 TRCN0000316298 CCTATGAGCATGGGATACAAA pLKO_005 2742 3UTR 100% 5.625 3.938 N Eps15 n/a
5 TRCN0000111724 GCCCACAAAGCGTTCTTGTTA pLKO.1 1693 CDS 100% 5.625 3.938 N Eps15 n/a
6 TRCN0000316223 GCCCACAAAGCGTTCTTGTTA pLKO_005 1693 CDS 100% 5.625 3.938 N Eps15 n/a
7 TRCN0000111722 GCAGACTTCTACTGATCCTTT pLKO.1 2135 CDS 100% 4.950 3.465 N Eps15 n/a
8 TRCN0000316296 GCAGACTTCTACTGATCCTTT pLKO_005 2135 CDS 100% 4.950 3.465 N Eps15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13856 pDONR223 100% 65.1% 65.1% None (many diffs) n/a
2 ccsbBroad304_13856 pLX_304 0% 65.1% 65.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476753 CAACAATCCGAAGTTAAAACCTCC pLX_317 15.4% 65.1% 65.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV