Transcript: Mouse XM_017321035.1

PREDICTED: Mus musculus ring finger protein 32 (Rnf32), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf32 (56874)
Length:
3521
CDS:
461..1177

Additional Resources:

NCBI RefSeq record:
XM_017321035.1
NBCI Gene record:
Rnf32 (56874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226361 CCGCCTTCGGATGCCAAATTA pLKO_005 884 CDS 100% 15.000 21.000 N Rnf32 n/a
2 TRCN0000226360 GCCTTACAGGACCACCTATTA pLKO_005 296 5UTR 100% 13.200 18.480 N Rnf32 n/a
3 TRCN0000039413 CGTTAGAAAGTGGTACAGAAA pLKO.1 847 CDS 100% 4.950 3.960 N Rnf32 n/a
4 TRCN0000217982 ACACCACCACCATTAACTTTA pLKO_005 497 CDS 100% 13.200 9.240 N Rnf32 n/a
5 TRCN0000039411 CCTCTGTAGAAAGAACCAATA pLKO.1 742 CDS 100% 10.800 7.560 N Rnf32 n/a
6 TRCN0000039410 GCCCAATATGTAAAGAAGAAT pLKO.1 624 CDS 100% 5.625 3.938 N Rnf32 n/a
7 TRCN0000039409 AGGAAGTTAAATGTCTGACTA pLKO.1 1188 3UTR 100% 4.950 3.465 N Rnf32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13201 pDONR223 100% 42.8% 43.8% None (many diffs) n/a
2 ccsbBroad304_13201 pLX_304 0% 42.8% 43.8% V5 (many diffs) n/a
3 TRCN0000469877 TTACACTTCTAATATACCATCCTT pLX_317 57.5% 42.8% 43.8% V5 (many diffs) n/a
4 TRCN0000487699 GAATAAAGAGTCCCGAAAGTGAGT pLX_317 34.3% 42.8% 43.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV