Transcript: Mouse XM_017321298.1

PREDICTED: Mus musculus glutamate receptor, metabotropic 7 (Grm7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grm7 (108073)
Length:
3288
CDS:
410..3184

Additional Resources:

NCBI RefSeq record:
XM_017321298.1
NBCI Gene record:
Grm7 (108073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216509 CAATCGGATTTATCGCATATT pLKO.1 2440 CDS 100% 13.200 18.480 N Grm7 n/a
2 TRCN0000194115 GTATCTACTCTTGCATCTGAA pLKO.1 1070 CDS 100% 4.950 6.930 N Grm7 n/a
3 TRCN0000241998 CTTGCCTTCATCCCAATATTT pLKO_005 2813 CDS 100% 15.000 10.500 N Grm7 n/a
4 TRCN0000242000 TTGCCAACGATGAGGATATAA pLKO_005 1266 CDS 100% 15.000 10.500 N Grm7 n/a
5 TRCN0000363191 TTGCCAACGATGAGGATATAA pLKO_005 1266 CDS 100% 15.000 10.500 N GRM7 n/a
6 TRCN0000241997 TGATGGATACCAGTATCAATT pLKO_005 2053 CDS 100% 13.200 9.240 N Grm7 n/a
7 TRCN0000241999 TTGGGTATGTGTATTAGTTAT pLKO_005 2399 CDS 100% 13.200 9.240 N Grm7 n/a
8 TRCN0000193427 CTATATCATCACCTTCCTAAT pLKO.1 2326 CDS 100% 10.800 7.560 N Grm7 n/a
9 TRCN0000009035 CCAGACTCATAAGCCCAACAT pLKO.1 2490 CDS 100% 4.950 3.465 N GRM7 n/a
10 TRCN0000175215 CTAGGTGTCTTTATTTGGTTT pLKO.1 2552 CDS 100% 4.950 3.465 N Grm7 n/a
11 TRCN0000367871 ATCGGATTTATCGCATATTTG pLKO_005 2442 CDS 100% 13.200 18.480 N GRM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488421 CTTACATAACTAACCGCCTCGATA pLX_317 11.8% 90% 96.4% V5 (many diffs) n/a
2 TRCN0000489148 ACCAAGACACGGACTTCTGAAGGA pLX_317 15.8% 90% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489177 TACTAAGGTTGACAGGTACAGTCG pLX_317 12.2% 89.9% 96.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV