Transcript: Mouse XM_017321401.1

PREDICTED: Mus musculus hexokinase 2 (Hk2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hk2 (15277)
Length:
4963
CDS:
241..2676

Additional Resources:

NCBI RefSeq record:
XM_017321401.1
NBCI Gene record:
Hk2 (15277)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000280175 CATCACCCTGCTGGTTCTAAA pLKO_005 3141 3UTR 100% 13.200 9.240 N Hk2 n/a
2 TRCN0000199240 CCCAGCTGTTTGACCACATTG pLKO.1 293 CDS 100% 10.800 7.560 N HK2 n/a
3 TRCN0000037672 CACTGTGAAGTTGGCCTCATT pLKO.1 1933 CDS 100% 4.950 3.465 N HK2 n/a
4 TRCN0000012545 CGGTACAGAGAAAGGAGACTT pLKO.1 1485 CDS 100% 4.950 3.465 N Hk2 n/a
5 TRCN0000280118 CGGTACAGAGAAAGGAGACTT pLKO_005 1485 CDS 100% 4.950 3.465 N Hk2 n/a
6 TRCN0000012544 GCCGTGGTAAATGACACAGTT pLKO.1 1879 CDS 100% 4.950 3.465 N Hk2 n/a
7 TRCN0000280174 GCCGTGGTAAATGACACAGTT pLKO_005 1879 CDS 100% 4.950 3.465 N Hk2 n/a
8 TRCN0000012543 GCGACATTTATAGGTGGAGAA pLKO.1 2980 3UTR 100% 4.050 2.835 N Hk2 n/a
9 TRCN0000012546 GCCAACTTCATGGACAAGCTA pLKO.1 325 CDS 100% 3.000 2.100 N Hk2 n/a
10 TRCN0000012547 GCTGGAGGTTAAGAGAAGGAT pLKO.1 1374 CDS 100% 3.000 2.100 N Hk2 n/a
11 TRCN0000280119 GCTGGAGGTTAAGAGAAGGAT pLKO_005 1374 CDS 100% 3.000 2.100 N Hk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14667 pDONR223 0% 77.2% 83.7% None (many diffs) n/a
2 ccsbBroad304_14667 pLX_304 0% 77.2% 83.7% V5 (many diffs) n/a
3 TRCN0000467008 CCTAATCTACTCTTGTATTGAAAG pLX_317 13.4% 77.2% 83.7% V5 (many diffs) n/a
4 TRCN0000488991 TATGTTCAGGTTCGCAGAACGATA pLX_317 11.8% 77.2% 83.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14666 pDONR223 54.9% 76.8% 82.9% None (many diffs) n/a
6 ccsbBroad304_14666 pLX_304 0% 76.8% 82.9% V5 (many diffs) n/a
7 TRCN0000480635 ATATTCCAATAGCCCATCCGTAAT pLX_317 16% 76.8% 82.9% V5 (many diffs) n/a
Download CSV