Transcript: Mouse XM_017321481.1

PREDICTED: Mus musculus succinate-Coenzyme A ligase, GDP-forming, beta subunit (Suclg2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Suclg2 (20917)
Length:
1474
CDS:
84..1034

Additional Resources:

NCBI RefSeq record:
XM_017321481.1
NBCI Gene record:
Suclg2 (20917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120826 CCAGTCCAGAACTCATCTTTA pLKO.1 634 CDS 100% 13.200 9.240 N Suclg2 n/a
2 TRCN0000341674 CCAGTCCAGAACTCATCTTTA pLKO_005 634 CDS 100% 13.200 9.240 N Suclg2 n/a
3 TRCN0000120824 GCCAGATACGATCTCAAGTAT pLKO.1 954 CDS 100% 5.625 3.938 N Suclg2 n/a
4 TRCN0000341675 GCCAGATACGATCTCAAGTAT pLKO_005 954 CDS 100% 5.625 3.938 N Suclg2 n/a
5 TRCN0000120823 CCCTGGATATTTCTAGAGAAA pLKO.1 520 CDS 100% 4.950 2.970 N Suclg2 n/a
6 TRCN0000341673 CCCTGGATATTTCTAGAGAAA pLKO_005 520 CDS 100% 4.950 2.970 N Suclg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11305 pDONR223 100% 54.3% 56.5% None (many diffs) n/a
2 ccsbBroad304_11305 pLX_304 0% 54.3% 56.5% V5 (many diffs) n/a
3 TRCN0000480412 ACAAGATCCAATTGACGCAGGTAT pLX_317 26.2% 54.3% 56.5% V5 (many diffs) n/a
Download CSV