Transcript: Mouse XM_017321733.1

PREDICTED: Mus musculus acylglycerol kinase (Agk), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agk (69923)
Length:
2584
CDS:
234..884

Additional Resources:

NCBI RefSeq record:
XM_017321733.1
NBCI Gene record:
Agk (69923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024799 CGTCTCTGTATAGGAGAATAT pLKO.1 433 CDS 100% 13.200 10.560 N Agk n/a
2 TRCN0000368281 TTGTGGTCAGTACCCTGTTAA pLKO_005 1058 3UTR 100% 13.200 10.560 N Agk n/a
3 TRCN0000368277 GTGAGGTTGTTCCCTCTTTAG pLKO_005 1377 3UTR 100% 10.800 7.560 N Agk n/a
4 TRCN0000358552 TCAGAGATGCTGGCGTCAAAG pLKO_005 259 CDS 100% 10.800 7.560 N AGK n/a
5 TRCN0000153540 CCATTGAACTGTCCATCACAA pLKO.1 544 CDS 100% 4.950 3.465 N AGK n/a
6 TRCN0000024803 CAGGAGGTTGTTACTGGAGTA pLKO.1 88 5UTR 100% 4.050 2.835 N Agk n/a
7 TRCN0000156414 CCACCATTGAACTGTCCATCA pLKO.1 541 CDS 100% 4.050 2.835 N AGK n/a
8 TRCN0000024802 CCTGATGAGCAAAGAGGATTT pLKO.1 584 CDS 100% 10.800 6.480 N Agk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08577 pDONR223 100% 43.5% 44.3% None (many diffs) n/a
2 ccsbBroad304_08577 pLX_304 0% 43.5% 44.3% V5 (many diffs) n/a
3 TRCN0000471201 TCAACACGTGCAGTGTTACCCGGG pLX_317 33% 43.5% 44.3% V5 (many diffs) n/a
4 ccsbBroadEn_15107 pDONR223 0% 43.5% 44.3% None (many diffs) n/a
5 TRCN0000472791 ATAGCGTTCTCAGCCTTGGACTTT pLX_317 32.8% 43.5% 44.3% V5 (many diffs) n/a
Download CSV