Transcript: Mouse XM_017322067.1

PREDICTED: Mus musculus cytoplasmic FMR1 interacting protein 1 (Cyfip1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyfip1 (20430)
Length:
3681
CDS:
1260..3341

Additional Resources:

NCBI RefSeq record:
XM_017322067.1
NBCI Gene record:
Cyfip1 (20430)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098316 CCCACCATATTGGACATAGAA pLKO.1 1338 CDS 100% 5.625 4.500 N Cyfip1 n/a
2 TRCN0000098317 CCAGAATATCTTACCTCGAAT pLKO.1 2663 CDS 100% 4.950 3.960 N Cyfip1 n/a
3 TRCN0000324542 CCAGAATATCTTACCTCGAAT pLKO_005 2663 CDS 100% 4.950 3.960 N Cyfip1 n/a
4 TRCN0000098319 CCAGATTCTCAACGATGAAAT pLKO.1 3212 CDS 100% 13.200 9.240 N Cyfip1 n/a
5 TRCN0000324623 CCAGATTCTCAACGATGAAAT pLKO_005 3212 CDS 100% 13.200 9.240 N Cyfip1 n/a
6 TRCN0000098315 CCAGTAACTGATGGCATGTTT pLKO.1 3361 3UTR 100% 5.625 3.375 N Cyfip1 n/a
7 TRCN0000324539 CCAGTAACTGATGGCATGTTT pLKO_005 3361 3UTR 100% 5.625 3.375 N Cyfip1 n/a
8 TRCN0000201485 CCTCTTGAGTGCTGGGATTAA pLKO.1 449 5UTR 100% 13.200 6.600 Y D830050J10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07850 pDONR223 100% 50% 54.6% None (many diffs) n/a
2 ccsbBroad304_07850 pLX_304 0% 50% 54.6% V5 (many diffs) n/a
3 TRCN0000478326 GAACCCGCTGGAAAAGCGTACGGA pLX_317 7.4% 50% 54.6% V5 (many diffs) n/a
Download CSV