Transcript: Mouse XM_017322186.1

PREDICTED: Mus musculus pleckstrin homology domain containing, family A member 7 (Plekha7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha7 (233765)
Length:
5242
CDS:
51..4130

Additional Resources:

NCBI RefSeq record:
XM_017322186.1
NBCI Gene record:
Plekha7 (233765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197954 GAGTGCGAATAAAGAGAACTA pLKO.1 2708 CDS 100% 4.950 6.930 N Plekha7 n/a
2 TRCN0000217253 CATAGGGATTCAGGTACTATG pLKO.1 4503 3UTR 100% 1.080 1.512 N Plekha7 n/a
3 TRCN0000285883 AGGAACGCTTCCGTGCTCAAA pLKO_005 1072 CDS 100% 4.950 3.960 N Plekha7 n/a
4 TRCN0000176982 GAGAATAAAGATCAGCTAGAA pLKO.1 2391 CDS 100% 4.950 3.960 N Plekha7 n/a
5 TRCN0000277176 GAGAATAAAGATCAGCTAGAA pLKO_005 2391 CDS 100% 4.950 3.960 N Plekha7 n/a
6 TRCN0000086691 TCGACCACAATCAGCAGACAA pLKO.1 265 CDS 100% 4.950 3.960 N LOC434230 n/a
7 TRCN0000277229 TACGCTGTCCAGGAAATTAAC pLKO_005 4649 3UTR 100% 13.200 9.240 N Plekha7 n/a
8 TRCN0000177782 CCAAGAGCACTAGACATCTTT pLKO.1 1462 CDS 100% 5.625 3.938 N Plekha7 n/a
9 TRCN0000086688 AGCTTCTTCATCGACCACAAT pLKO.1 255 CDS 100% 4.950 3.465 N LOC434230 n/a
10 TRCN0000176483 CGGATAATCAACATTTCCTAT pLKO.1 3966 CDS 100% 4.950 3.465 N Plekha7 n/a
11 TRCN0000285881 GGGCATGAGGACCTACTACTT pLKO_005 812 CDS 100% 4.950 3.465 N Plekha7 n/a
12 TRCN0000177783 CATTGATGTCAAGCTGAGCAT pLKO.1 2312 CDS 100% 2.640 1.848 N Plekha7 n/a
13 TRCN0000277178 CATTGATGTCAAGCTGAGCAT pLKO_005 2312 CDS 100% 2.640 1.848 N Plekha7 n/a
14 TRCN0000086690 GCAGACAACAACATTCAGGCA pLKO.1 278 CDS 100% 0.660 0.462 N LOC434230 n/a
15 TRCN0000086689 CCGCGTCTTCTTCATCAATGA pLKO.1 116 CDS 100% 4.950 2.970 N LOC434230 n/a
16 TRCN0000086692 GCATCCTGTGACTGGACAGTT pLKO.1 296 CDS 100% 4.950 2.970 N LOC434230 n/a
17 TRCN0000118445 GCAGACAACAACATTCAGGAT pLKO.1 278 CDS 100% 2.640 1.848 N HERC2P9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14391 pDONR223 100% 47.1% 49.6% None (many diffs) n/a
2 ccsbBroad304_14391 pLX_304 0% 47.1% 49.6% V5 (many diffs) n/a
3 TRCN0000480609 CACTGCCAGTATACCGGTAATTGT pLX_317 17.5% 47.1% 49.6% V5 (many diffs) n/a
Download CSV