Transcript: Mouse XM_017322198.1

PREDICTED: Mus musculus pleckstrin homology domain containing, family A member 7 (Plekha7), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha7 (233765)
Length:
3398
CDS:
286..2286

Additional Resources:

NCBI RefSeq record:
XM_017322198.1
NBCI Gene record:
Plekha7 (233765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197954 GAGTGCGAATAAAGAGAACTA pLKO.1 864 CDS 100% 4.950 6.930 N Plekha7 n/a
2 TRCN0000217253 CATAGGGATTCAGGTACTATG pLKO.1 2659 3UTR 100% 1.080 1.512 N Plekha7 n/a
3 TRCN0000176982 GAGAATAAAGATCAGCTAGAA pLKO.1 547 CDS 100% 4.950 3.960 N Plekha7 n/a
4 TRCN0000277176 GAGAATAAAGATCAGCTAGAA pLKO_005 547 CDS 100% 4.950 3.960 N Plekha7 n/a
5 TRCN0000277229 TACGCTGTCCAGGAAATTAAC pLKO_005 2805 3UTR 100% 13.200 9.240 N Plekha7 n/a
6 TRCN0000176483 CGGATAATCAACATTTCCTAT pLKO.1 2122 CDS 100% 4.950 3.465 N Plekha7 n/a
7 TRCN0000177783 CATTGATGTCAAGCTGAGCAT pLKO.1 468 CDS 100% 2.640 1.848 N Plekha7 n/a
8 TRCN0000277178 CATTGATGTCAAGCTGAGCAT pLKO_005 468 CDS 100% 2.640 1.848 N Plekha7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14391 pDONR223 100% 45.3% 43.9% None (many diffs) n/a
2 ccsbBroad304_14391 pLX_304 0% 45.3% 43.9% V5 (many diffs) n/a
3 TRCN0000480609 CACTGCCAGTATACCGGTAATTGT pLX_317 17.5% 45.3% 43.9% V5 (many diffs) n/a
Download CSV