Transcript: Mouse XM_017322297.1

PREDICTED: Mus musculus calcium binding protein 5 (Cabp5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cabp5 (29865)
Length:
1899
CDS:
350..820

Additional Resources:

NCBI RefSeq record:
XM_017322297.1
NBCI Gene record:
Cabp5 (29865)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071786 CATGAGAACGATGGGTTACAT pLKO.1 466 CDS 100% 5.625 7.875 N Cabp5 n/a
2 TRCN0000071787 CTTCAAGGAGTTTGATGCCAA pLKO.1 637 CDS 100% 2.640 2.112 N Cabp5 n/a
3 TRCN0000071783 CGGGAAGCATTTCTTGAATTT pLKO.1 398 CDS 100% 13.200 9.240 N Cabp5 n/a
4 TRCN0000071784 GTTCATCTCTTACAAGGATTT pLKO.1 436 CDS 100% 10.800 7.560 N Cabp5 n/a
5 TRCN0000071785 CACTGTTGACTTTGAAGAGTT pLKO.1 778 CDS 100% 4.950 2.970 N Cabp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03721 pDONR223 100% 79.4% 80.9% None (many diffs) n/a
2 ccsbBroad304_03721 pLX_304 0% 79.4% 80.9% V5 (many diffs) n/a
3 TRCN0000469253 ACTTCCATTGTTTATTGGACCATC pLX_317 77.6% 79.4% 80.9% V5 (many diffs) n/a
Download CSV