Transcript: Human XM_024446455.1

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 16 (ARHGEF16), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF16 (27237)
Length:
1874
CDS:
81..1346

Additional Resources:

NCBI RefSeq record:
XM_024446455.1
NBCI Gene record:
ARHGEF16 (27237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308159 GAGGCACCAATAGCGATTATT pLKO_005 1678 3UTR 100% 15.000 21.000 N ARHGEF16 n/a
2 TRCN0000296257 AGATCCTCACGTCGGAGTTCT pLKO_005 88 CDS 100% 4.950 6.930 N ARHGEF16 n/a
3 TRCN0000047507 GCTGGACTTCAGCAAGGTCAA pLKO.1 668 CDS 100% 4.050 2.835 N ARHGEF16 n/a
4 TRCN0000289517 GCTGGACTTCAGCAAGGTCAA pLKO_005 668 CDS 100% 4.050 2.835 N ARHGEF16 n/a
5 TRCN0000047503 GCAGAAGCTGATAAGCAGCAA pLKO.1 380 CDS 100% 2.640 1.848 N ARHGEF16 n/a
6 TRCN0000047504 AGCTGTTCTTAGTGGAAGAAA pLKO.1 736 CDS 100% 0.563 0.394 N ARHGEF16 n/a
7 TRCN0000047505 GCGGGTGGAGACGGACGTGTA pLKO.1 1325 CDS 100% 0.000 0.000 N ARHGEF16 n/a
8 TRCN0000251391 ACTGCTCCAACGAGGTCTATC pLKO_005 346 CDS 100% 10.800 7.560 N Arhgef16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446455.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11857 pDONR223 100% 99.7% 99.7% None 244C>T;627T>C;813G>A n/a
2 ccsbBroad304_11857 pLX_304 0% 99.7% 99.7% V5 244C>T;627T>C;813G>A n/a
3 TRCN0000480706 TAAGGGACCGCTCACGGTCCCATG pLX_317 34.6% 99.7% 99.7% V5 244C>T;627T>C;813G>A n/a
Download CSV