Transcript: Human XM_024446456.1

PREDICTED: Homo sapiens mitochondrial pyruvate carrier 1 (MPC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPC1 (51660)
Length:
2335
CDS:
1625..1825

Additional Resources:

NCBI RefSeq record:
XM_024446456.1
NBCI Gene record:
MPC1 (51660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005486 GCGGCTTATCAAACACGAGAT pLKO.1 1783 CDS 100% 4.050 5.670 N MPC1 n/a
2 TRCN0000005485 GCTGCCTTACAAGTATTAAAT pLKO.1 1991 3UTR 100% 15.000 12.000 N MPC1 n/a
3 TRCN0000005489 AGAGATTATCAGTGGGCGGAT pLKO.1 1639 CDS 100% 2.160 1.728 N MPC1 n/a
4 TRCN0000422578 ATTTGCCCTCTGTTGCTATTC pLKO_005 1663 CDS 100% 10.800 7.560 N MPC1 n/a
5 TRCN0000005487 GCTGCCATCAATGATATGAAA pLKO.1 1610 5UTR 100% 5.625 3.938 N MPC1 n/a
6 TRCN0000005488 GCCTCGGAACTGGCTTCTGTT pLKO.1 1717 CDS 100% 1.650 1.155 N MPC1 n/a
7 TRCN0000420072 TGAGTCACAGATTTCATTATA pLKO_005 1878 3UTR 100% 15.000 9.000 N MPC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03358 pDONR223 100% 60.5% 60.5% None 0_1ins129 n/a
2 ccsbBroad304_03358 pLX_304 0% 60.5% 60.5% V5 0_1ins129 n/a
3 TRCN0000472659 TCGAGCATATCACAATCCAGGTTT pLX_317 100% 60.5% 60.5% V5 0_1ins129 n/a
Download CSV