Transcript: Human XM_024446516.1

PREDICTED: Homo sapiens tRNA methyltransferase 11 homolog (TRMT11), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRMT11 (60487)
Length:
2657
CDS:
1525..2217

Additional Resources:

NCBI RefSeq record:
XM_024446516.1
NBCI Gene record:
TRMT11 (60487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276167 TCTATTGGTTACCGGTGTATA pLKO_005 1937 CDS 100% 13.200 18.480 N TRMT11 n/a
2 TRCN0000276166 TGCCATACCAAGGTCATAATT pLKO_005 2126 CDS 100% 15.000 10.500 N TRMT11 n/a
3 TRCN0000161645 GATGGACAGAGAGAGCTTATT pLKO.1 675 5UTR 100% 13.200 9.240 N TRMT11 n/a
4 TRCN0000161341 GCTGATAGCATGTGCTCATTT pLKO.1 833 5UTR 100% 13.200 9.240 N TRMT11 n/a
5 TRCN0000276098 GACATCTGGATGTGAACTTTC pLKO_005 2266 3UTR 100% 10.800 7.560 N TRMT11 n/a
6 TRCN0000159429 GCACTTGAATTTCTGCCATTT pLKO.1 534 5UTR 100% 10.800 7.560 N TRMT11 n/a
7 TRCN0000319401 GCACTTGAATTTCTGCCATTT pLKO_005 534 5UTR 100% 10.800 7.560 N TRMT11 n/a
8 TRCN0000158425 CCTGTTTCCTTGAGTTATCAT pLKO.1 1849 CDS 100% 5.625 3.938 N TRMT11 n/a
9 TRCN0000276165 CCTGTTTCCTTGAGTTATCAT pLKO_005 1849 CDS 100% 5.625 3.938 N TRMT11 n/a
10 TRCN0000166781 CCAAACTGCATCCCTGAGAAT pLKO.1 621 5UTR 100% 4.950 3.465 N TRMT11 n/a
11 TRCN0000159341 GAGAGAGCTTATTGAGTCATA pLKO.1 683 5UTR 100% 4.950 3.465 N TRMT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08794 pDONR223 100% 48.1% 44.9% None (many diffs) n/a
2 ccsbBroad304_08794 pLX_304 0% 48.1% 44.9% V5 (many diffs) n/a
3 TRCN0000478001 ACTTGACGTTACCGTTCGACTTCC pLX_317 20.3% 48.1% 44.9% V5 (many diffs) n/a
Download CSV