Transcript: Human XM_024446565.1

PREDICTED: Homo sapiens lin-9 DREAM MuvB core complex component (LIN9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIN9 (286826)
Length:
3295
CDS:
206..1951

Additional Resources:

NCBI RefSeq record:
XM_024446565.1
NBCI Gene record:
LIN9 (286826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233307 CAGCGGAGATATGCAACAATT pLKO_005 1475 CDS 100% 13.200 18.480 N LIN9 n/a
2 TRCN0000233304 ACGAAAGTTACAGCACGATTA pLKO_005 1094 CDS 100% 10.800 15.120 N LIN9 n/a
3 TRCN0000121646 GCATTGAATTTCAGCGGAGAT pLKO.1 1464 CDS 100% 4.050 5.670 N LIN9 n/a
4 TRCN0000115874 CGCTTCTAATATCAGTTGCTT pLKO.1 1831 CDS 100% 3.000 4.200 N LIN9 n/a
5 TRCN0000115873 GCTTCTAATATCAGTTGCTTT pLKO.1 1832 CDS 100% 4.950 3.960 N LIN9 n/a
6 TRCN0000115872 CCACTGAAATATAGATGGGAA pLKO.1 2463 3UTR 100% 2.640 2.112 N LIN9 n/a
7 TRCN0000233308 ACATGGTTCTGTAGATCATTT pLKO_005 2526 3UTR 100% 13.200 9.240 N LIN9 n/a
8 TRCN0000233305 TACTCTTAATGCTACTTATAG pLKO_005 1162 CDS 100% 13.200 9.240 N LIN9 n/a
9 TRCN0000115876 CCTGTTTGGAAAGGCAGGAAT pLKO.1 542 CDS 100% 4.950 3.465 N LIN9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05418 pDONR223 100% 82.8% 81.9% None (many diffs) n/a
2 ccsbBroad304_05418 pLX_304 0% 82.8% 81.9% V5 (many diffs) n/a
3 TRCN0000477195 AGCCGCGAGTGTTGAGATGACAAT pLX_317 16.3% 82.8% 81.9% V5 (many diffs) n/a
Download CSV