Transcript: Human XM_024446581.1

PREDICTED: Homo sapiens muscular LMNA interacting protein (MLIP), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLIP (90523)
Length:
1667
CDS:
77..1297

Additional Resources:

NCBI RefSeq record:
XM_024446581.1
NBCI Gene record:
MLIP (90523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418788 GTCATCCAATGGTGGCTATTC pLKO_005 1242 CDS 100% 10.800 15.120 N MLIP n/a
2 TRCN0000136123 GAAGATAACAGCGACCTCTTT pLKO.1 1004 CDS 100% 4.950 6.930 N MLIP n/a
3 TRCN0000167535 GCTACCATTGATAAGGTCTTA pLKO.1 716 CDS 100% 4.950 6.930 N MLIP n/a
4 TRCN0000135473 GCTCTTGATTCCAAAGAGCAA pLKO.1 1274 CDS 100% 0.264 0.370 N MLIP n/a
5 TRCN0000423763 TGTCTCGCTCCATCCTTTATA pLKO_005 1057 CDS 100% 15.000 10.500 N MLIP n/a
6 TRCN0000425898 AGAGAGAGACCAAGCGAAATT pLKO_005 184 CDS 100% 13.200 9.240 N MLIP n/a
7 TRCN0000136328 CAGAATGAGTGCTCCCTTTAT pLKO.1 1389 3UTR 100% 13.200 9.240 N MLIP n/a
8 TRCN0000419761 GCTAACCACTTGCTAGATTTA pLKO_005 1351 3UTR 100% 13.200 9.240 N MLIP n/a
9 TRCN0000341594 TGACTAAGCCTGGAGTAATTC pLKO_005 903 CDS 100% 13.200 9.240 N Mlip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14334 pDONR223 100% 56.8% 54.6% None (many diffs) n/a
2 ccsbBroad304_14334 pLX_304 0% 56.8% 54.6% V5 (many diffs) n/a
3 TRCN0000472297 TCATACACCCCACCGAACTATCCG pLX_317 62% 56.8% 54.6% V5 (many diffs) n/a
Download CSV