Transcript: Human XM_024446591.1

PREDICTED: Homo sapiens G protein nucleolar 2 (GNL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNL2 (29889)
Length:
2344
CDS:
383..2305

Additional Resources:

NCBI RefSeq record:
XM_024446591.1
NBCI Gene record:
GNL2 (29889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047470 GCAAGGATCGTGATTTGGTAA pLKO.1 435 CDS 100% 4.950 6.930 N GNL2 n/a
2 TRCN0000286316 GCAAGGATCGTGATTTGGTAA pLKO_005 435 CDS 100% 4.950 6.930 N GNL2 n/a
3 TRCN0000047472 CCAAACTTATTTGCAAGTGAT pLKO.1 362 5UTR 100% 4.950 3.960 N GNL2 n/a
4 TRCN0000293696 GAACAGGAACATTCAAATAAA pLKO_005 2105 CDS 100% 15.000 10.500 N GNL2 n/a
5 TRCN0000293756 TTCAGCTTCTGCGGCAGTTTG pLKO_005 789 CDS 100% 10.800 7.560 N GNL2 n/a
6 TRCN0000293755 TTCCATGCAAGCCTTACTAAC pLKO_005 746 CDS 100% 10.800 7.560 N GNL2 n/a
7 TRCN0000047471 GTGGGTAAGATGGTCCTCAAT pLKO.1 1436 CDS 100% 4.950 3.465 N GNL2 n/a
8 TRCN0000047468 GCCGTTATTAAAGCACTGGAT pLKO.1 1892 CDS 100% 2.640 1.848 N GNL2 n/a
9 TRCN0000286317 GCCGTTATTAAAGCACTGGAT pLKO_005 1892 CDS 100% 2.640 1.848 N GNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03098 pDONR223 100% 71.5% 71.5% None 0_1ins477;433_636del n/a
2 ccsbBroad304_03098 pLX_304 0% 71.5% 71.5% V5 0_1ins477;433_636del n/a
3 TRCN0000481021 CTGTCAGCAAGAATCATGGTGATC pLX_317 20.4% 71.5% 71.5% V5 0_1ins477;433_636del n/a
4 ccsbBroadEn_08132 pDONR223 100% 71.5% 71.4% None 0_1ins477;374G>T;433_636del n/a
5 ccsbBroad304_08132 pLX_304 0% 71.5% 71.4% V5 0_1ins477;374G>T;433_636del n/a
6 TRCN0000466706 ACCCTTCTGGGCTTCCTGTGATGA pLX_317 18.3% 71.5% 71.4% V5 0_1ins477;374G>T;433_636del n/a
Download CSV