Transcript: Human XM_024446592.1

PREDICTED: Homo sapiens TATA-box binding protein like 1 (TBPL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBPL1 (9519)
Length:
1790
CDS:
778..1338

Additional Resources:

NCBI RefSeq record:
XM_024446592.1
NBCI Gene record:
TBPL1 (9519)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274265 CTGCTGTGTGCTATCGGATAA pLKO_005 1184 CDS 100% 10.800 15.120 N TBPL1 n/a
2 TRCN0000013464 GCCAGTTACGAACCTGAACTT pLKO.1 1159 CDS 100% 4.950 6.930 N TBPL1 n/a
3 TRCN0000274262 CCAAACCTTGCTGTAATATAA pLKO_005 1495 3UTR 100% 15.000 10.500 N TBPL1 n/a
4 TRCN0000274327 CAAGTGAAGAAGAAGCTAAAT pLKO_005 992 CDS 100% 13.200 9.240 N TBPL1 n/a
5 TRCN0000119930 CCTAGAATTACAGCTACAATT pLKO.1 937 CDS 100% 13.200 9.240 N Tbpl1 n/a
6 TRCN0000329247 CCTAGAATTACAGCTACAATT pLKO_005 937 CDS 100% 13.200 9.240 N Tbpl1 n/a
7 TRCN0000375314 GGGCACCAAAGAACCTGTAAA pLKO_005 1721 3UTR 100% 13.200 9.240 N Tbpl1 n/a
8 TRCN0000013463 CACCACTTAATTGGTTAGAAT pLKO.1 1341 3UTR 100% 5.625 3.938 N TBPL1 n/a
9 TRCN0000013466 GTGTGTAACATGCCATTTGAA pLKO.1 1099 CDS 100% 5.625 3.938 N TBPL1 n/a
10 TRCN0000013467 TGTGGAACAGATTTACCCATT pLKO.1 1287 CDS 100% 4.050 2.835 N TBPL1 n/a
11 TRCN0000274329 TGTGGAACAGATTTACCCATT pLKO_005 1287 CDS 100% 4.050 2.835 N TBPL1 n/a
12 TRCN0000013465 ACCTAGAATTACAGCTACAAT pLKO.1 936 CDS 100% 5.625 3.375 N TBPL1 n/a
13 TRCN0000274264 ACCTAGAATTACAGCTACAAT pLKO_005 936 CDS 100% 5.625 3.375 N TBPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446592.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478439 ATCCGCCCTTAGCAGCACTGAATC pLX_317 66.2% 99.8% 99.4% V5 131T>N n/a
2 ccsbBroadEn_07437 pDONR223 100% 99.6% 98.9% None 131T>N;536T>N n/a
3 ccsbBroad304_07437 pLX_304 0% 99.6% 98.9% V5 131T>N;536T>N n/a
Download CSV