Transcript: Human XM_024446651.1

PREDICTED: Homo sapiens deltex E3 ubiquitin ligase 2 (DTX2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTX2 (113878)
Length:
2283
CDS:
183..1889

Additional Resources:

NCBI RefSeq record:
XM_024446651.1
NBCI Gene record:
DTX2 (113878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237865 CAGAGATGGACCGCAACATTA pLKO_005 1774 CDS 100% 13.200 9.240 N DTX2 n/a
2 TRCN0000004560 AGGCATGACGAGTGTTCTGAT pLKO.1 1190 CDS 100% 4.950 3.465 N DTX2 n/a
3 TRCN0000237864 GCTTAGGATGCAGCTACCTCA pLKO_005 2100 3UTR 100% 2.640 1.848 N DTX2 n/a
4 TRCN0000004559 CAAGACAGAGATGGACCGCAA pLKO.1 1769 CDS 100% 2.160 1.512 N DTX2 n/a
5 TRCN0000237863 CAGAGCCAGAGCAGGTCATAA pLKO_005 1354 CDS 100% 13.200 6.600 Y DTX2 n/a
6 TRCN0000237866 CATGTACTGCAACGGCAATAA pLKO_005 1550 CDS 100% 13.200 6.600 Y DTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09391 pDONR223 100% 91.1% 91.1% None (many diffs) n/a
2 ccsbBroad304_09391 pLX_304 0% 91.1% 91.1% V5 (many diffs) n/a
3 TRCN0000471473 ATTTTGGCTCATCCCTCGGTGGAC pLX_317 24.2% 91.1% 91.1% V5 (many diffs) n/a
Download CSV