Transcript: Human XM_024446707.1

PREDICTED: Homo sapiens glucokinase (GCK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCK (2645)
Length:
1463
CDS:
341..598

Additional Resources:

NCBI RefSeq record:
XM_024446707.1
NBCI Gene record:
GCK (2645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010267 CGACCGCAAGCAGATCTACAA pLKO.1 229 5UTR 100% 4.950 6.930 N GCK n/a
2 TRCN0000199353 CGAGGACGTAATGCGCATCAC pLKO.1 394 CDS 100% 1.350 1.890 N GCK n/a
3 TRCN0000194703 CCTTTCTCGCTGGAATCAATT pLKO.1 844 3UTR 100% 13.200 9.240 N GCK n/a
4 TRCN0000195021 CTCAGGACTTTGATGCATTTC pLKO.1 885 3UTR 100% 10.800 7.560 N GCK n/a
5 TRCN0000199354 CGTGGATGGCTCCGTGTACAA pLKO.1 421 CDS 100% 1.650 1.155 N GCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00624 pDONR223 100% 18.2% 18.2% None 0_1ins1140 n/a
2 ccsbBroad304_00624 pLX_304 0% 18.2% 18.2% V5 0_1ins1140 n/a
3 TRCN0000468306 GCGATAACTTATGCTACTCCATAT pLX_317 31.6% 18.2% 18.2% V5 0_1ins1140 n/a
4 ccsbBroadEn_14654 pDONR223 0% 18.2% 18.2% None 0_1ins1140 n/a
5 ccsbBroad304_14654 pLX_304 0% 18.2% 18.2% V5 0_1ins1140 n/a
6 TRCN0000480104 TCCTATTCACCTTTCACATAAAAC pLX_317 25.5% 18.2% 18.2% V5 0_1ins1140 n/a
7 TRCN0000489651 ACAGAGTAGCGGTATCCGCCCAAT pLX_317 25.1% 18.2% 18.2% V5 (not translated due to prior stop codon) 0_1ins1140 n/a
8 TRCN0000489668 TGCTACGCCATCCATTGTTCTGGC pLX_317 24.9% 18.2% 18.2% V5 (not translated due to prior stop codon) 0_1ins1140 n/a
9 TRCN0000489255 TCACTGTGAAGAAGTACTGAATTT pLX_317 28.6% 18.2% 18.2% V5 0_1ins1140;255_256insG n/a
Download CSV