Transcript: Human XM_024446827.1

PREDICTED: Homo sapiens cytochrome c oxidase assembly factor 1 homolog (COA1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COA1 (55744)
Length:
10449
CDS:
357..797

Additional Resources:

NCBI RefSeq record:
XM_024446827.1
NBCI Gene record:
COA1 (55744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145132 GCCATTGTGTATTACCTCATT pLKO.1 447 CDS 100% 4.950 6.930 N COA1 n/a
2 TRCN0000144830 GCTGTATAAACGCAACAACAA pLKO.1 1373 3UTR 100% 4.950 6.930 N COA1 n/a
3 TRCN0000144831 GTTGATGCCAAGTTGAAGATT pLKO.1 609 CDS 100% 5.625 3.938 N COA1 n/a
4 TRCN0000143935 CCAGGGCTTTATATTACAAGT pLKO.1 481 CDS 100% 4.950 3.465 N COA1 n/a
5 TRCN0000140758 GTCAGCAGATTCCTGTGTTCA pLKO.1 736 CDS 100% 4.950 3.465 N COA1 n/a
6 TRCN0000122690 GCCTGCTAACACAGTATCCAT pLKO.1 1711 3UTR 100% 3.000 2.100 N COA1 n/a
7 TRCN0000140634 GCAGATTCCTGTGTTCAAGCT pLKO.1 740 CDS 100% 2.640 1.848 N COA1 n/a
8 TRCN0000438319 CTCTGGGAGCAAGGATCCTTT pLKO_005 397 CDS 100% 4.950 2.970 N COA1 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2833 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2833 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 6067 3UTR 100% 4.950 2.475 Y GJD4 n/a
12 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 6067 3UTR 100% 4.950 2.475 Y C9orf85 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 6106 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 6106 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 6106 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1585 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2831 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2831 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2831 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1588 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03646 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03646 pLX_304 0% 100% 100% V5 n/a
Download CSV