Transcript: Human XM_024446854.1

PREDICTED: Homo sapiens Ras homolog, mTORC1 binding (RHEB), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHEB (6009)
Length:
2248
CDS:
620..1141

Additional Resources:

NCBI RefSeq record:
XM_024446854.1
NBCI Gene record:
RHEB (6009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039598 CCCTCCCTTCAGATTATGTTA pLKO.1 1273 3UTR 100% 5.625 7.875 N RHEB n/a
2 TRCN0000039600 CAAGTCTTCATGCTCGGTGAT pLKO.1 1117 CDS 100% 4.050 5.670 N RHEB n/a
3 TRCN0000010425 TTATGTTGGTTGGGAATAAGA pLKO.1 927 CDS 100% 5.625 3.375 N RHEB n/a
4 TRCN0000039599 CCTATTATGTTGGTTGGGAAT pLKO.1 923 CDS 100% 4.050 2.430 N RHEB n/a
5 TRCN0000009865 TATCATCTTCAACTTGTAGAC pLKO.1 746 CDS 100% 4.050 2.430 N RHEB n/a
6 TRCN0000415710 ATGGAAAGGGTGATCAGTTAT pLKO_005 959 CDS 100% 13.200 6.600 Y RHEB n/a
7 TRCN0000435736 CAAAGTTGATCACAGTAAATG pLKO_005 717 CDS 100% 13.200 6.600 Y RHEB n/a
8 TRCN0000436662 CAATTTGTTGAAGGCCAATTT pLKO_005 659 CDS 100% 13.200 6.600 Y RHEB n/a
9 TRCN0000075605 CAGACATACTCCATAGATATT pLKO.1 800 CDS 100% 13.200 6.600 Y Rheb n/a
10 TRCN0000039602 CCGGGCAAGATGAATATTCTA pLKO.1 771 CDS 100% 5.625 2.813 Y RHEB n/a
11 TRCN0000039601 CCTACGATCCAACCATAGAAA pLKO.1 687 CDS 100% 5.625 2.813 Y RHEB n/a
12 TRCN0000010424 CCTCAGACATACTCCATAGAT pLKO.1 797 CDS 100% 5.625 2.813 Y RHEB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446854.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01398 pDONR223 100% 91.5% 91.3% None (many diffs) n/a
2 ccsbBroad304_01398 pLX_304 98.4% 91.5% 91.3% V5 (many diffs) n/a
3 TRCN0000468386 ATTCCCATCTACATCCAGAAAAAC pLX_317 61.3% 91.5% 91.3% V5 (many diffs) n/a
4 ccsbBroadEn_06864 pDONR223 100% 91.3% 90.7% None (many diffs) n/a
5 ccsbBroad304_06864 pLX_304 98.4% 91.3% 90.7% V5 (many diffs) n/a
6 TRCN0000475474 AGGTGTTTCACCGGGTTTCGAGCT pLX_317 49.6% 91.3% 90.7% V5 (many diffs) n/a
Download CSV