Transcript: Human XM_024446926.1

PREDICTED: Homo sapiens zinc finger protein 3 (ZNF3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF3 (7551)
Length:
2573
CDS:
156..1403

Additional Resources:

NCBI RefSeq record:
XM_024446926.1
NBCI Gene record:
ZNF3 (7551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235716 CTGCGCTCCTAAAGGCCAAGT pLKO_005 166 CDS 100% 1.350 1.890 N ZNF3 n/a
2 TRCN0000016296 GCAAGAGCTTTAATCGAACTT pLKO.1 679 CDS 100% 4.950 3.960 N ZNF3 n/a
3 TRCN0000235714 GAAGCGTTTGGAACCTGCTCA pLKO_005 257 CDS 100% 2.640 2.112 N ZNF3 n/a
4 TRCN0000016295 CCCTTATTCACCATCAGAGAA pLKO.1 1039 CDS 100% 4.950 3.465 N ZNF3 n/a
5 TRCN0000244325 GTGTACTTCATCCGGAAGGAG pLKO_005 234 CDS 100% 2.640 1.848 N ZNF3 n/a
6 TRCN0000016294 CCCATAAGTGTGATGAATGTA pLKO.1 658 CDS 100% 5.625 3.375 N ZNF3 n/a
7 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 294 CDS 100% 13.200 6.600 Y Zfp874a n/a
8 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1314 CDS 100% 6.000 3.000 Y Zfp612 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11225 pDONR223 100% 98.7% 98.7% None 34_48del n/a
2 ccsbBroad304_11225 pLX_304 0% 98.7% 98.7% V5 34_48del n/a
3 TRCN0000474154 AGTTCAAACAAGGCAGTCGGGATT pLX_317 29.6% 98.7% 98.7% V5 34_48del n/a
4 ccsbBroadEn_11227 pDONR223 100% 98.7% 98.5% None 34_48del;212T>C n/a
5 ccsbBroadEn_07146 pDONR223 100% 90.7% 90.4% None (many diffs) n/a
6 ccsbBroad304_07146 pLX_304 0% 90.7% 90.4% V5 (many diffs) n/a
7 TRCN0000471384 AGCCGGTTGGCAACCTCGTACTTA pLX_317 33.4% 90.7% 90.4% V5 (many diffs) n/a
Download CSV