Transcript: Human XM_024447055.1

PREDICTED: Homo sapiens RNA binding protein, mRNA processing factor (RBPMS), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBPMS (11030)
Length:
814
CDS:
240..713

Additional Resources:

NCBI RefSeq record:
XM_024447055.1
NBCI Gene record:
RBPMS (11030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429813 ATCCGCTTCGATCCTGAAATT pLKO_005 303 CDS 100% 13.200 18.480 N RBPMS n/a
2 TRCN0000163579 GCTAAGGCAAACACGAAGATG pLKO.1 348 CDS 100% 4.950 6.930 N RBPMS n/a
3 TRCN0000164592 CCAAGAACAAACTCGTAGGGA pLKO.1 370 CDS 100% 0.750 1.050 N RBPMS n/a
4 TRCN0000123737 CGACTAGAGTTTGCTAAGGCA pLKO.1 336 CDS 100% 0.750 1.050 N Rbpms n/a
5 TRCN0000164568 CGACTAGAGTTTGCTAAGGCA pLKO.1 336 CDS 100% 0.750 1.050 N RBPMS n/a
6 TRCN0000161776 CAACACTGTACCTCAGTTCAT pLKO.1 416 CDS 100% 4.950 3.465 N RBPMS n/a
7 TRCN0000160934 GTTTGCTAAGGCAAACACGAA pLKO.1 344 CDS 100% 0.264 0.185 N RBPMS n/a
8 TRCN0000431659 TATGAGCTCACAGTGCCTGCA pLKO_005 450 CDS 100% 2.160 1.296 N RBPMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02600 pDONR223 100% 68.3% 64.3% None (many diffs) n/a
2 ccsbBroad304_02600 pLX_304 0% 68.3% 64.3% V5 (many diffs) n/a
3 TRCN0000472652 AAGGAAGCGCAAATAACGCCACCT pLX_317 57.7% 68.3% 64.3% V5 (many diffs) n/a
Download CSV