Transcript: Human XM_024447172.1

PREDICTED: Homo sapiens zinc finger protein 706 (ZNF706), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF706 (51123)
Length:
1780
CDS:
735..965

Additional Resources:

NCBI RefSeq record:
XM_024447172.1
NBCI Gene record:
ZNF706 (51123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173891 GTCTGTAGGACACAAATGCCA pLKO.1 861 CDS 100% 0.750 1.050 N Zfp706 n/a
2 TRCN0000277184 GTCTGTAGGACACAAATGCCA pLKO_005 861 CDS 100% 0.750 1.050 N Zfp706 n/a
3 TRCN0000415011 GGGCTACAGAAACACTCATTT pLKO_005 1076 3UTR 100% 13.200 9.240 N ZNF706 n/a
4 TRCN0000219803 TTCAGGCATAAGGTTGTTTAC pLKO.1 955 CDS 100% 10.800 7.560 N ZNF706 n/a
5 TRCN0000219802 CACAAATGCCAGACCCTAAGA pLKO.1 871 CDS 100% 4.950 3.465 N ZNF706 n/a
6 TRCN0000130253 CTTCCTCCAGAATTAGCTGAT pLKO.1 933 CDS 100% 4.050 2.835 N ZNF706 n/a
7 TRCN0000147852 GCCTTAATATATACCTGCACT pLKO.1 840 CDS 100% 2.640 1.848 N ZNF706 n/a
8 TRCN0000175288 CCAAAGCTGCCTTAATATATA pLKO.1 832 CDS 100% 15.000 9.000 N Zfp706 n/a
9 TRCN0000285884 CCAAAGCTGCCTTAATATATA pLKO_005 832 CDS 100% 15.000 9.000 N Zfp706 n/a
10 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 709 5UTR 100% 13.200 6.600 Y CLDN18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03219 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03219 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465504 CCTACGACCGATCGCTCAAAGTCC pLX_317 100% 100% 100% V5 n/a
Download CSV