Transcript: Human XM_024447235.1

PREDICTED: Homo sapiens solute carrier family 20 member 2 (SLC20A2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC20A2 (6575)
Length:
3593
CDS:
307..2265

Additional Resources:

NCBI RefSeq record:
XM_024447235.1
NBCI Gene record:
SLC20A2 (6575)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433539 CACCTTCCCGAGCTAACTTAA pLKO_005 2442 3UTR 100% 13.200 18.480 N SLC20A2 n/a
2 TRCN0000427569 GGCGGCAATGACGTGAGTAAT pLKO_005 1813 CDS 100% 13.200 18.480 N SLC20A2 n/a
3 TRCN0000043073 CAAAGGTATCATTGACGTGAA pLKO.1 519 CDS 100% 4.050 5.670 N SLC20A2 n/a
4 TRCN0000421288 TGTACCACACCGTGCACAAAG pLKO_005 1334 CDS 100% 10.800 7.560 N SLC20A2 n/a
5 TRCN0000043075 GTCATGGCTCTTCTCATGTAT pLKO.1 2224 CDS 100% 5.625 3.938 N SLC20A2 n/a
6 TRCN0000043077 GCTGCGCCGAAACAACAGTTA pLKO.1 1443 CDS 100% 4.950 3.465 N SLC20A2 n/a
7 TRCN0000043074 CATAGCTTTCATCTTGGCCTT pLKO.1 351 CDS 100% 2.160 1.512 N SLC20A2 n/a
8 TRCN0000043076 CTATGCTGCTACCATAGCAAT pLKO.1 864 CDS 100% 0.495 0.347 N SLC20A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06971 pDONR223 100% 99.8% 99.6% None 1940G>T;1943T>C n/a
2 TRCN0000476345 AACTTACATGAACCCCTCCTAACT pLX_317 15.7% 99.8% 99.6% V5 1940G>T;1943T>C n/a
Download CSV