Transcript: Human XM_024447573.1

PREDICTED: Homo sapiens phosphoglucomutase 5 (PGM5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PGM5 (5239)
Length:
2013
CDS:
545..1609

Additional Resources:

NCBI RefSeq record:
XM_024447573.1
NBCI Gene record:
PGM5 (5239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049099 CCCAGCCAATTCTGCAATAAA pLKO.1 1288 CDS 100% 15.000 7.500 Y PGM5P1 n/a
2 TRCN0000049102 CCTCTCTTGCATTCCATATTT pLKO.1 1507 CDS 100% 15.000 7.500 Y PGM5P1 n/a
3 TRCN0000049101 CCTGACCCAAACCTGACATAT pLKO.1 1343 CDS 100% 13.200 6.600 Y PGM5P1 n/a
4 TRCN0000049061 CGACTGATTATTGGACAGAAT pLKO.1 812 CDS 100% 4.950 2.475 Y PGM5 n/a
5 TRCN0000200822 GTGAAGTTTAATGTTGCCAAT pLKO.1 944 CDS 100% 4.050 2.025 Y Pgm5 n/a
6 TRCN0000413827 GCAACTACCTGCCCAACTTCA pLKO_005 657 CDS 100% 4.950 2.475 Y Pgm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13919 pDONR223 100% 74.7% 73.6% None (many diffs) n/a
2 ccsbBroad304_13919 pLX_304 0% 74.7% 73.6% V5 (many diffs) n/a
3 TRCN0000475957 AAGTCTTGGATCATGTTCTGTATA pLX_317 30.8% 74.7% 73.6% V5 (many diffs) n/a
Download CSV