Transcript: Human XM_024447727.1

PREDICTED: Homo sapiens POU class 2 homeobox 1 (POU2F1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU2F1 (5451)
Length:
14055
CDS:
294..2525

Additional Resources:

NCBI RefSeq record:
XM_024447727.1
NBCI Gene record:
POU2F1 (5451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020765 CCAAACTACCATCTCTCGATT pLKO.1 1259 CDS 100% 4.950 6.930 N POU2F1 n/a
2 TRCN0000232118 GACCAGCAGCTCACCTATTAA pLKO_005 1625 CDS 100% 15.000 12.000 N POU2F1 n/a
3 TRCN0000232120 GCAACTGGGAACCTGGTATTT pLKO_005 2256 CDS 100% 13.200 10.560 N POU2F1 n/a
4 TRCN0000240639 GCAACTGGGAACCTGGTATTT pLKO_005 2256 CDS 100% 13.200 10.560 N Pou2f1 n/a
5 TRCN0000232119 ACAACACAGCAACCGTGATTT pLKO_005 1801 CDS 100% 13.200 9.240 N POU2F1 n/a
6 TRCN0000232117 ACCTCGGAAGAGATCACTATG pLKO_005 1506 CDS 100% 10.800 7.560 N POU2F1 n/a
7 TRCN0000232121 TTTCACTCTGCAGTGTGATTG pLKO_005 2556 3UTR 100% 10.800 7.560 N POU2F1 n/a
8 TRCN0000175090 GCTGCTCAGTCTTTAAATGTA pLKO.1 483 CDS 100% 5.625 3.938 N Pou2f1 n/a
9 TRCN0000020766 GCTGTGACGAATCTTTCAGTT pLKO.1 1755 CDS 100% 4.950 3.465 N POU2F1 n/a
10 TRCN0000020768 CCAGTCAACACCAAAGCGAAT pLKO.1 1094 CDS 100% 4.050 2.835 N POU2F1 n/a
11 TRCN0000020767 GAGGACAGATAACTGGGCTTA pLKO.1 610 CDS 100% 4.050 2.835 N POU2F1 n/a
12 TRCN0000020764 GCAAAGGAGAGAAGGGAGAAA pLKO.1 2639 3UTR 100% 4.950 2.970 N POU2F1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7134 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7134 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11046 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11046 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471094 GGGAGACTGCATGAGGCTTGATTA pLX_317 19.3% 100% 100% V5 n/a
Download CSV