Transcript: Human XM_024448036.1

PREDICTED: Homo sapiens WW domain containing adaptor with coiled-coil (WAC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WAC (51322)
Length:
3317
CDS:
116..1924

Additional Resources:

NCBI RefSeq record:
XM_024448036.1
NBCI Gene record:
WAC (51322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273664 ATGTATCCTTCACGTTGTAAA pLKO_005 2129 3UTR 100% 13.200 18.480 N WAC n/a
2 TRCN0000135667 GCATCAAGATTACGCGAAGAA pLKO.1 1727 CDS 100% 4.950 6.930 N WAC n/a
3 TRCN0000135994 GCAGTGATTGAGCATAACCTA pLKO.1 2630 3UTR 100% 3.000 4.200 N WAC n/a
4 TRCN0000135201 CTCAAACTAACACAGTCCCTA pLKO.1 1353 CDS 100% 2.640 3.696 N WAC n/a
5 TRCN0000138407 CGGAGATCTGATAGTCCTGAA pLKO.1 158 CDS 100% 4.050 3.240 N WAC n/a
6 TRCN0000273610 CGGAGATCTGATAGTCCTGAA pLKO_005 158 CDS 100% 4.050 3.240 N WAC n/a
7 TRCN0000345721 CAATGCTGAGGTGGCTAAATA pLKO_005 2214 3UTR 100% 15.000 10.500 N Wac n/a
8 TRCN0000273609 CTATTCACATGTCCGAAATTT pLKO_005 1764 CDS 100% 15.000 10.500 N WAC n/a
9 TRCN0000273608 GCGAGAGCAAAGGATACTATT pLKO_005 1843 CDS 100% 13.200 9.240 N WAC n/a
10 TRCN0000193841 CCAGTTACTCTCCACAAGAAA pLKO.1 258 CDS 100% 5.625 3.938 N Wac n/a
11 TRCN0000345718 CCAGTTACTCTCCACAAGAAA pLKO_005 258 CDS 100% 5.625 3.938 N Wac n/a
12 TRCN0000133639 GTCGAACAGAAGTTTCACAAT pLKO.1 429 CDS 100% 4.950 3.465 N WAC n/a
13 TRCN0000273607 GTCGAACAGAAGTTTCACAAT pLKO_005 429 CDS 100% 4.950 3.465 N WAC n/a
14 TRCN0000137728 GCCATCTAATCAGTCTCCGAT pLKO.1 1273 CDS 100% 2.640 1.848 N WAC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11974 pDONR223 100% 92.5% 91.8% None 0_1ins135;1782_1783delAA;1806_1807insTGAAGATG n/a
2 ccsbBroad304_11974 pLX_304 0% 92.5% 91.8% V5 0_1ins135;1782_1783delAA;1806_1807insTGAAGATG n/a
3 TRCN0000480363 TCCTATGTCTCACCCTGGACAAAC pLX_317 23.5% 92.5% 91.8% V5 0_1ins135;1782_1783delAA;1806_1807insTGAAGATG n/a
Download CSV