Transcript: Human XM_024448094.1

PREDICTED: Homo sapiens aldehyde dehydrogenase 18 family member A1 (ALDH18A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALDH18A1 (5832)
Length:
3647
CDS:
334..2823

Additional Resources:

NCBI RefSeq record:
XM_024448094.1
NBCI Gene record:
ALDH18A1 (5832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064852 GCATCTATTGTTGAGCAGGTA pLKO.1 619 CDS 100% 2.640 2.112 N ALDH18A1 n/a
2 TRCN0000434520 ACTTTGCCAAGTCCAATTATC pLKO_005 3056 3UTR 100% 13.200 9.240 N ALDH18A1 n/a
3 TRCN0000455026 AGGCCGTGCAACTGGTGAATA pLKO_005 1925 CDS 100% 13.200 9.240 N ALDH18A1 n/a
4 TRCN0000413267 TTCACGTTAAACTTGTCTTAT pLKO_005 2861 3UTR 100% 13.200 9.240 N ALDH18A1 n/a
5 TRCN0000415272 TTCCGAGGCCAGTGTTGATAA pLKO_005 2100 CDS 100% 13.200 9.240 N ALDH18A1 n/a
6 TRCN0000421109 TTGGAGCAACATCCCGTTTAT pLKO_005 459 CDS 100% 13.200 9.240 N ALDH18A1 n/a
7 TRCN0000422978 ACTAGAGCCAGTCATCCTTAA pLKO_005 3182 3UTR 100% 10.800 7.560 N ALDH18A1 n/a
8 TRCN0000436081 GGAATCAGTACATCGAGAATC pLKO_005 2653 CDS 100% 10.800 7.560 N ALDH18A1 n/a
9 TRCN0000064850 CGGAACCTCAATGGAACACTT pLKO.1 934 CDS 100% 4.950 3.465 N ALDH18A1 n/a
10 TRCN0000064849 CCATTATTTGACCAGATCATT pLKO.1 2317 CDS 100% 5.625 3.375 N ALDH18A1 n/a
11 TRCN0000064848 GCCTTGTATGAGGCTATGTTT pLKO.1 844 CDS 100% 5.625 3.375 N ALDH18A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491568 ACAGTCCCGTAAACGATTCTAGGC pLX_317 13.3% 95.8% 95.7% V5 1800_1901del;2487_2488insG n/a
2 ccsbBroadEn_14822 pDONR223 68.3% 94.9% 28.5% None (many diffs) n/a
3 ccsbBroad304_14822 pLX_304 0% 94.9% 28.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000475053 AGCACTCTCGGTAAAAATCCACGC pLX_317 17.5% 94.9% 28.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV