Transcript: Human XM_024448167.1

PREDICTED: Homo sapiens coiled-coil domain containing 7 (CCDC7), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC7 (79741)
Length:
4613
CDS:
1012..4254

Additional Resources:

NCBI RefSeq record:
XM_024448167.1
NBCI Gene record:
CCDC7 (79741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424953 GGACGTAGCATACCAGATAAA pLKO_005 2656 CDS 100% 13.200 18.480 N CCDC7 n/a
2 TRCN0000128807 CCATTCCATCGAGTAAGACAA pLKO.1 375 5UTR 100% 4.950 6.930 N CCDC7 n/a
3 TRCN0000130260 CCGTGAAAGTCATGTTGTCTA pLKO.1 822 5UTR 100% 4.950 6.930 N CCDC7 n/a
4 TRCN0000128246 GCAGAAATAGTAAGGCTTGTA pLKO.1 752 5UTR 100% 4.950 6.930 N CCDC7 n/a
5 TRCN0000417657 ATGCAATTAAGACGCAGTTAA pLKO_005 3326 CDS 100% 13.200 10.560 N CCDC7 n/a
6 TRCN0000130295 CGGCAAATGTTCCAGCATTAA pLKO.1 213 5UTR 100% 13.200 10.560 N CCDC7 n/a
7 TRCN0000442313 GTTTCCCTGGGCCTGATATAG pLKO_005 3185 CDS 100% 13.200 10.560 N CCDC7 n/a
8 TRCN0000130461 GAAGAACTGAAGAATCGCCTT pLKO.1 782 5UTR 100% 2.160 1.728 N CCDC7 n/a
9 TRCN0000425544 GCTTTGGGAAGACGCTTATTA pLKO_005 3136 CDS 100% 15.000 10.500 N CCDC7 n/a
10 TRCN0000425836 GCGAATCTCAAACGAAGAAAC pLKO_005 2954 CDS 100% 10.800 7.560 N CCDC7 n/a
11 TRCN0000130087 CAAAGCGGAAGACTGATTGAA pLKO.1 1525 CDS 100% 5.625 3.938 N CCDC7 n/a
12 TRCN0000129232 CTATGGACATTGCGATCAGAA pLKO.1 475 5UTR 100% 4.950 3.465 N CCDC7 n/a
13 TRCN0000168662 GCTGGAAATACAGTGGATCAA pLKO.1 4381 3UTR 100% 4.950 3.465 N CCDC7 n/a
14 TRCN0000129043 GACAACAATGCAAGTGGGTAA pLKO.1 1371 CDS 100% 4.050 2.835 N CCDC7 n/a
15 TRCN0000129676 CAGAAGATGAAATGATCGGAA pLKO.1 408 5UTR 100% 2.640 1.848 N CCDC7 n/a
16 TRCN0000130183 CAGGTCAATCAGATGGAAGAA pLKO.1 662 5UTR 100% 4.950 2.970 N CCDC7 n/a
17 TRCN0000167455 GCAACATGACAAATTCAGAAA pLKO.1 4282 3UTR 100% 4.950 2.970 N CCDC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05247 pDONR223 100% 13% 12.9% None (many diffs) n/a
2 ccsbBroad304_05247 pLX_304 0% 13% 12.9% V5 (many diffs) n/a
3 TRCN0000474906 ACCAACGAGAACCAAGGACGGAGG pLX_317 31.4% 13% 12.9% V5 (many diffs) n/a
Download CSV