Transcript: Human XM_024448239.1

PREDICTED: Homo sapiens solute carrier family 22 member 15 (SLC22A15), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A15 (55356)
Length:
1628
CDS:
91..1302

Additional Resources:

NCBI RefSeq record:
XM_024448239.1
NBCI Gene record:
SLC22A15 (55356)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038256 CGGTGGTCTTTCTCTTATCTT pLKO.1 797 CDS 100% 5.625 7.875 N SLC22A15 n/a
2 TRCN0000038254 CCTCTCTGTATCTACTTGATT pLKO.1 1144 CDS 100% 5.625 3.938 N SLC22A15 n/a
3 TRCN0000112837 CTGGCCTCATAGAGATTCCAT pLKO.1 1118 CDS 100% 3.000 2.100 N Slc22a15 n/a
4 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1592 3UTR 100% 4.950 2.475 Y CFLAR n/a
5 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1592 3UTR 100% 4.950 2.475 Y C19orf31 n/a
6 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1590 3UTR 100% 4.950 2.475 Y ERN2 n/a
7 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1590 3UTR 100% 4.950 2.475 Y P3H4 n/a
8 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1590 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12211 pDONR223 100% 70.5% 69.4% None (many diffs) n/a
2 ccsbBroad304_12211 pLX_304 0% 70.5% 69.4% V5 (many diffs) n/a
3 TRCN0000471410 CGAGGAGAACTGCCCATGACCTAC pLX_317 23.7% 70.5% 69.4% V5 (many diffs) n/a
Download CSV