Construct: ORF TRCN0000471410
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013273.1_s317c1
- Derived from:
- ccsbBroadEn_12211
- DNA Barcode:
- CGAGGAGAACTGCCCATGACCTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC22A15 (55356)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471410
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55356 | SLC22A15 | solute carrier family 22 me... | NM_018420.3 | 97.6% | 97.6% | (many diffs) |
| 2 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XM_024448238.1 | 73.2% | 67.7% | (many diffs) |
| 3 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XM_024448239.1 | 70.5% | 69.4% | (many diffs) |
| 4 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957032.1 | 58.7% | (many diffs) | |
| 5 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957031.1 | 56.2% | (many diffs) | |
| 6 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XM_005271004.3 | 55.7% | 55.3% | (many diffs) |
| 7 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957034.1 | 55.4% | (many diffs) | |
| 8 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957029.1 | 54.7% | (many diffs) | |
| 9 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957035.1 | 54.5% | (many diffs) | |
| 10 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957030.1 | 54.2% | (many diffs) | |
| 11 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957033.1 | 51.7% | (many diffs) | |
| 12 | human | 55356 | SLC22A15 | solute carrier family 22 me... | XR_002957027.1 | 43.4% | (many diffs) | |
| 13 | mouse | 242126 | Slc22a15 | solute carrier family 22 (o... | NM_001039371.2 | 85.5% | 91.4% | (many diffs) |
| 14 | mouse | 242126 | Slc22a15 | solute carrier family 22 (o... | XR_001783691.1 | 19.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1671
- ORF length:
- 1605
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg catctaccag atgtacttgt gcttcctgct ggccgtgctg ctgcagctct 121 acgtggccac ggaggccatc ctcattgcac tggttggggc cacgccatcc taccactggg 181 acctggcaga gctcctgcca aatcagagcc acggtaacca gtcagctggt gaagaccagg 241 cctttgggga ctggctcctg acagccaacg gcagtgagat ccataagcac gtgcatttca 301 gcagcagctt cacctccatc gcctcggagt ggtttttaat tgccaacaga tcctacaaag 361 tcagtgcagc aagctctttt ttcttcagtg gtgtatttgt tggagttatc tcttttggtc 421 agctttcaga tcgcttcgga aggaaaaaag tctatctcac aggttttgct cttgacatct 481 tatttgcaat tgcaaatgga ttttccccct catatgagtt ctttgcagta actcgcttcc 541 tggtgggcat gatgaatgga gggatgtcgc tggtggcctt tgtcttgctt aatgagtgtg 601 tgggcaccgc ctactgggca cttgcaggat cgattggcgg cctcttcttt gcagttggca 661 ttgcccaata tgccctgtta ggatacttca tccgctcctg gaggacccta gccattctgg 721 ttaacctgca gggaacggtg gtctttctct tatctttatt cattcctgaa tcacctcgtt 781 ggttatactc ccagggtcga ctgagtgagg ctgaagaggc gctgtacctc attgccaaga 841 ggaaccgcaa actcaagtgc acgttctcac taacacaccc agccaacagg agctgcaggg 901 agactggaag tttcctggat ctctttcgtt accgggtcct gttaggacac actttgatcc 961 tgatgttcat ctggtttgtg tgcagcttgg tgtattatgg cctaactctg agtgcgggtg 1021 atctaggtgg aagtatttat gccaacctgg ccctgtctgg cctcatagag attcaatctt 1081 accctctctg tatctacttg attaaccaaa aatggtttgg tcggaagcga acattatcag 1141 catttctgtg cctaggagga ctggcttgtc ttattgtaat gtttcttcca gaaaagaaag 1201 acacaggtgt gtttgcagtg gtgaacagcc attccttgtc cttgctgggg aagctgacca 1261 tcagtgctgc ctttaacatt gtttatatct acaccTCTGA GCTTTACCCT ACAGTCATCA 1321 GGAATGTTGG GCTTGGAACT TGTTCCATGT TCTCCCGAGT TGGTGGGATT ATTGCTCCCT 1381 TCATCCCCTC ACTGAAATAT GTGCAATGGT CTTTACCATT CATTGTCTTC GGAGCCACGG 1441 GTCTGACCTC CGGCCTCCTG AGTTTGTTAT TGCCGGAGAC CCTTAACAGT CCGCTGCTAG 1501 AAACATTCTC CGACCTTCAG GTGTATTCGT ATCGCAGGCT GGGAGAAGAA GCATTATCTT 1561 TACAGGCTTT GGACCCCCAA CAGTGTGTGG ACAAGGAGAG CTCTTTAGGG AGTGAGAGTG 1621 AGGAAGAGGA AGAATTTTAT GATGCAGATG AAGAGACTCA GATGATCAAG TGCCCAACTT 1681 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1741 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1801 CTTGTGGAAA GGACGACGAG GAGAACTGCC CATGACCTAC ACGCGTTAAG TCgacaatca 1861 acctctggat tacaaaattt gtgaaagatt