Transcript: Human XM_024448337.1

PREDICTED: Homo sapiens checkpoint kinase 1 (CHEK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHEK1 (1111)
Length:
3585
CDS:
332..1762

Additional Resources:

NCBI RefSeq record:
XM_024448337.1
NBCI Gene record:
CHEK1 (1111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145520 TGGTATTGGAATAACTCACA pXPR_003 GGG 382 27% 5 0.8955 CHEK1 CHEK1 76643
2 BRDN0001146941 ACACCACCTGAAGTGACTCG pXPR_003 GGG 831 58% 9 0.0465 CHEK1 CHEK1 76641
3 BRDN0001147255 TTTCTGGAGTACTGTAGTGG pXPR_003 AGG 263 18% 3 -0.1320 CHEK1 CHEK1 76642
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039853 GCAACAGTATTTCGGTATAAT pLKO.1 785 CDS 100% 15.000 21.000 N CHEK1 n/a
2 TRCN0000199796 GTGACAGCTGTCAGGAGTATT pLKO.1 966 CDS 100% 13.200 18.480 N CHEK1 n/a
3 TRCN0000039854 CTAAGCACATTCAATCCAATT pLKO.1 1203 CDS 100% 10.800 15.120 N CHEK1 n/a
4 TRCN0000009826 AAGCGTGCCGTAGACTGTCCA pLKO.1 458 CDS 100% 0.000 0.000 N CHEK1 n/a
5 TRCN0000039855 GTTGTATGAATCAGGTTACTA pLKO.1 1551 CDS 100% 5.625 4.500 N CHEK1 n/a
6 TRCN0000009947 GACAGAATAGAGCCAGACATA pLKO.1 611 CDS 100% 4.950 3.960 N CHEK1 n/a
7 TRCN0000196688 GAGAAGGCAATATCCAATATT pLKO.1 555 CDS 100% 15.000 10.500 N CHEK1 n/a
8 TRCN0000000500 CGCAGTGAAGATTGTAGATAT pLKO.1 436 CDS 100% 13.200 9.240 N CHEK1 n/a
9 TRCN0000415741 GACACTTCCTGAAGATTAAAG pLKO_005 1689 CDS 100% 13.200 9.240 N Chek1 n/a
10 TRCN0000039856 GCCCACATGTCCTGATCATAT pLKO.1 1369 CDS 100% 13.200 9.240 N CHEK1 n/a
11 TRCN0000428582 GTCCTGTGGAATAGTACTTAC pLKO_005 907 CDS 100% 10.800 7.560 N Chek1 n/a
12 TRCN0000000502 GTGGTTTATCTGCATGGTATT pLKO.1 683 CDS 100% 10.800 7.560 N CHEK1 n/a
13 TRCN0000196788 GAATTACCATTCCAGACATCA pLKO.1 1089 CDS 100% 4.950 3.465 N CHEK1 n/a
14 TRCN0000196839 GACATTATTCTTCCTAGAGAA pLKO.1 1812 3UTR 100% 4.950 3.465 N CHEK1 n/a
15 TRCN0000000501 GCTGTGAATAGAGTAACTGAA pLKO.1 407 CDS 100% 4.950 3.465 N CHEK1 n/a
16 TRCN0000009942 GTAAACAGTGCTTCTAGTGAA pLKO.1 1238 CDS 100% 4.950 3.465 N CHEK1 n/a
17 TRCN0000009949 TAATCGTGAGCGTTTGTTGAA pLKO.1 805 CDS 100% 4.950 3.465 N CHEK1 n/a
18 TRCN0000039857 CAAATCTTATCAATGCCTGAA pLKO.1 1492 CDS 100% 4.050 2.835 N CHEK1 n/a
19 TRCN0000000499 CTGCAAATAGTAGTTCCTGAA pLKO.1 1852 3UTR 100% 4.050 2.835 N CHEK1 n/a
20 TRCN0000000503 GAAGATTAAAGGGAAGCTGAT pLKO.1 1699 CDS 100% 4.050 2.835 N CHEK1 n/a
21 TRCN0000009948 GGGTGGTTTATCTGCATGGTA pLKO.1 681 CDS 100% 3.000 2.100 N CHEK1 n/a
22 TRCN0000009828 GAATCCTGGTGAATATAGTGC pLKO.1 1782 3UTR 100% 2.640 1.848 N CHEK1 n/a
23 TRCN0000009946 GACAAATCTTATCAATGCCTG pLKO.1 1490 CDS 100% 2.160 1.512 N CHEK1 n/a
24 TRCN0000195025 CCCTCATACATTGATAAATTG pLKO.1 1325 CDS 100% 13.200 7.920 N CHEK1 n/a
25 TRCN0000199027 CCTCTAGCTCTGCTGCATAAA pLKO.1 1043 CDS 100% 13.200 7.920 N CHEK1 n/a
26 TRCN0000009827 TGATATTGTGAGCAGCCAGAA pLKO.1 1720 CDS 100% 4.050 2.430 N CHEK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488974 ATCGCGTACCGCGCCTTATAACAT pLX_317 19.9% 99.9% 99.7% V5 (not translated due to prior stop codon) 1411A>G n/a
2 ccsbBroadEn_14582 pDONR223 100% 98.6% 45.4% None (many diffs) n/a
3 ccsbBroad304_14582 pLX_304 0% 98.6% 45.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV