Transcript: Human XM_024448396.1

PREDICTED: Homo sapiens protein kinase C zeta (PRKCZ), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCZ (5590)
Length:
2814
CDS:
396..1634

Additional Resources:

NCBI RefSeq record:
XM_024448396.1
NBCI Gene record:
PRKCZ (5590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149519 CCTGCTTCCAGACGACAAGT pXPR_003 CGG 420 34% 7 0.5543 PRKCZ PRKCZ 76632
2 BRDN0001145480 CCCCACCCCCAGGTTCTACG pXPR_003 CGG 517 42% 9 0.2018 PRKCZ PRKCZ 76633
3 BRDN0001145473 CAGCATTAAAGACGACTCGG pXPR_003 AGG 133 11% 5 -0.1381 PRKCZ PRKCZ 76631
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001221 GCCTCCAGTAGACGACAAGAA pLKO.1 422 CDS 100% 4.950 6.930 N PRKCZ n/a
2 TRCN0000010112 CTGTCCGTCAAAGCCTCCCAT pLKO.1 1287 CDS 100% 0.880 0.704 N PRKCZ n/a
3 TRCN0000195238 CAGATGGAATTGCTTACATTT pLKO.1 472 CDS 100% 13.200 9.240 N PRKCZ n/a
4 TRCN0000274627 CTTCCAAGCCAAGCGCTTTAA pLKO_005 242 5UTR 100% 13.200 9.240 N Prkcz n/a
5 TRCN0000199050 CTGCAGGACTTTGACCTAATC pLKO.1 591 CDS 100% 10.800 7.560 N PRKCZ n/a
6 TRCN0000001220 CTGGTGCGGTTGAAGAAGAAT pLKO.1 648 CDS 100% 5.625 3.938 N PRKCZ n/a
7 TRCN0000010114 CATGAAAGTGGTGAAGAAAGA pLKO.1 683 CDS 100% 4.950 3.465 N PRKCZ n/a
8 TRCN0000010121 GTTGTTCCTGGTCATTGAGTA pLKO.1 821 CDS 100% 4.950 3.465 N PRKCZ n/a
9 TRCN0000199469 GTTCGACATCATCACCGACAA pLKO.1 1196 CDS 100% 4.050 2.835 N PRKCZ n/a
10 TRCN0000010120 CAAGCTCACAGACTACGGCAT pLKO.1 1016 CDS 100% 2.160 1.512 N PRKCZ n/a
11 TRCN0000001222 CCCGGACATGAACACAGAGGA pLKO.1 1217 CDS 100% 0.880 0.616 N PRKCZ n/a
12 TRCN0000010113 ACCTAATCAGAGTCATCGGGC pLKO.1 604 CDS 100% 0.540 0.378 N PRKCZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489417 TCCGCGACTATAACAATCCGTGAA pLX_317 19.5% 61.6% 56.7% V5 (many diffs) n/a
2 ccsbBroadEn_01284 pDONR223 100% 61.5% 56.8% None (many diffs) n/a
3 ccsbBroad304_01284 pLX_304 33.6% 61.5% 56.8% V5 (many diffs) n/a
4 TRCN0000468951 TCTAGCACTATCAGGCTTACCTCC pLX_317 19.9% 61.5% 56.8% V5 (many diffs) n/a
5 ccsbBroadEn_14796 pDONR223 0% 61.5% 56.8% None (many diffs) n/a
6 ccsbBroad304_14796 pLX_304 33.6% 61.5% 56.8% V5 (many diffs) n/a
7 TRCN0000471650 GCTGTAGTGTGCCCGCTGAGGCCT pLX_317 23.7% 61.5% 56.8% V5 (many diffs) n/a
8 TRCN0000488644 CACGCTAGCACGACATTCTTTGCC pLX_317 18.5% 61.5% 56.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489003 GTAAATACAATCATGACTCATCGG pLX_317 20.2% 61.5% 56.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV