Transcript: Human XM_024448405.1

PREDICTED: Homo sapiens G protein subunit gamma 12 (GNG12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNG12 (55970)
Length:
4294
CDS:
102..320

Additional Resources:

NCBI RefSeq record:
XM_024448405.1
NBCI Gene record:
GNG12 (55970)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448405.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154024 CCGATATGTCAGGACCTAAAT pLKO.1 633 3UTR 100% 13.200 18.480 N GNG12 n/a
2 TRCN0000150926 GTGCAGCAGTTAAGATTAGAA pLKO.1 153 CDS 100% 5.625 7.875 N GNG12 n/a
3 TRCN0000152909 GCAAATTATGAGCAGCTCCTT pLKO.1 359 3UTR 100% 2.640 3.696 N GNG12 n/a
4 TRCN0000153572 GCTCATGTTCTCTACTGGATT pLKO.1 1170 3UTR 100% 4.950 3.960 N GNG12 n/a
5 TRCN0000150820 GAATAAAGGTTTCGAAGGCAT pLKO.1 187 CDS 100% 2.640 2.112 N GNG12 n/a
6 TRCN0000152112 CTGATAGGAATACCAACTTCA pLKO.1 258 CDS 100% 4.950 3.465 N GNG12 n/a
7 TRCN0000153982 CCACTTGGTAACTATGGCTTT pLKO.1 533 3UTR 100% 4.050 2.835 N GNG12 n/a
8 TRCN0000150847 GATAGGAATACCAACTTCAGA pLKO.1 260 CDS 100% 3.000 2.100 N GNG12 n/a
9 TRCN0000156535 GTGACCCTTTGCTGATAGGAA pLKO.1 247 CDS 100% 3.000 2.100 N GNG12 n/a
10 TRCN0000153035 GAACTGTGCAGCAGTTAAGAT pLKO.1 148 CDS 100% 0.563 0.394 N GNG12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448405.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08615 pDONR223 100% 99.5% 98.6% None 85A>G n/a
2 ccsbBroad304_08615 pLX_304 0% 99.5% 98.6% V5 85A>G n/a
3 TRCN0000465877 AACAGAGGGTGCTGCATACATATC pLX_317 100% 99.5% 98.6% V5 85A>G n/a
Download CSV