Transcript: Human XM_024448779.1

PREDICTED: Homo sapiens centrosomal protein 57 (CEP57), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP57 (9702)
Length:
3091
CDS:
350..1654

Additional Resources:

NCBI RefSeq record:
XM_024448779.1
NBCI Gene record:
CEP57 (9702)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145516 GCAGGATGACTCAATGTTAAA pLKO.1 1810 3UTR 100% 13.200 18.480 N CEP57 n/a
2 TRCN0000141011 CCTTCGGATAAGCCTTTCCTT pLKO.1 386 CDS 100% 3.000 4.200 N CEP57 n/a
3 TRCN0000278858 CCTTCGGATAAGCCTTTCCTT pLKO_005 386 CDS 100% 3.000 4.200 N CEP57 n/a
4 TRCN0000122199 GATCGAGTCATCAACAGTATT pLKO.1 1121 CDS 100% 13.200 10.560 N CEP57 n/a
5 TRCN0000278924 GATCGAGTCATCAACAGTATT pLKO_005 1121 CDS 100% 13.200 10.560 N CEP57 n/a
6 TRCN0000141796 GCTGAGCCATCAAGGTCTAAT pLKO.1 323 5UTR 100% 13.200 10.560 N CEP57 n/a
7 TRCN0000297573 GCTGAGCCATCAAGGTCTAAT pLKO_005 323 5UTR 100% 13.200 10.560 N CEP57 n/a
8 TRCN0000143009 CGGCATTCTTCATCTCCATAT pLKO.1 356 CDS 100% 10.800 8.640 N CEP57 n/a
9 TRCN0000278923 CGGCATTCTTCATCTCCATAT pLKO_005 356 CDS 100% 10.800 8.640 N CEP57 n/a
10 TRCN0000122750 CCAGGTCTCATACTCACTTAT pLKO.1 1725 3UTR 100% 13.200 9.240 N CEP57 n/a
11 TRCN0000143673 GAGTGTGAATTGGAGGCATTA pLKO.1 1343 CDS 100% 10.800 7.560 N CEP57 n/a
12 TRCN0000144105 CAGATACAAGAAAGGGAGAAT pLKO.1 599 CDS 100% 4.950 3.465 N CEP57 n/a
13 TRCN0000278860 CAGATACAAGAAAGGGAGAAT pLKO_005 599 CDS 100% 4.950 3.465 N CEP57 n/a
14 TRCN0000142782 CAGGCAGAAGAAAGTGTGAAA pLKO.1 533 CDS 100% 4.950 3.465 N CEP57 n/a
15 TRCN0000144002 CAGTTATTGAAGGACATGCAA pLKO.1 1586 CDS 100% 3.000 2.100 N CEP57 n/a
16 TRCN0000424830 ATTGGAATACATGCGAAATAT pLKO_005 706 CDS 100% 15.000 9.000 N Cep57 n/a
17 TRCN0000121760 CAGACTTTACAGGATGAATTT pLKO.1 1244 CDS 100% 13.200 7.920 N CEP57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448779.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11406 pDONR223 100% 40.7% 40.6% None (many diffs) n/a
2 ccsbBroad304_11406 pLX_304 0% 40.7% 40.6% V5 (many diffs) n/a
3 TRCN0000472167 GTGGCTCGCATGTCCTGGGGGTCG pLX_317 60% 40.7% 40.6% V5 (many diffs) n/a
Download CSV