Transcript: Human XM_024448840.1

PREDICTED: Homo sapiens FYVE, RhoGEF and PH domain containing 4 (FGD4), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGD4 (121512)
Length:
7380
CDS:
454..1863

Additional Resources:

NCBI RefSeq record:
XM_024448840.1
NBCI Gene record:
FGD4 (121512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048235 CCGAGATAATGAAGTGACAAT pLKO.1 1233 CDS 100% 4.950 6.930 N FGD4 n/a
2 TRCN0000048234 GCCATTCTAATAGTGCAATAA pLKO.1 725 CDS 100% 13.200 9.240 N FGD4 n/a
3 TRCN0000446100 GACACGAAGGAGGCATCATTG pLKO_005 1287 CDS 100% 10.800 7.560 N FGD4 n/a
4 TRCN0000425877 AGAATGAGCACTTCCATTTAA pLKO_005 2161 3UTR 100% 15.000 9.000 N FGD4 n/a
5 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 6787 3UTR 100% 4.950 2.475 Y ORAI2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6861 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6994 3UTR 100% 10.800 5.400 Y SMIM11A n/a
8 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 6784 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13083 pDONR223 100% 78% 74.8% None (many diffs) n/a
2 ccsbBroad304_13083 pLX_304 0% 78% 74.8% V5 (many diffs) n/a
3 TRCN0000491703 AGACAAAGGTGCAGGATCGAAAAT pLX_317 24.1% 78% 74.8% V5 (many diffs) n/a
Download CSV