Transcript: Human XM_024448849.1

PREDICTED: Homo sapiens solute carrier family 2 member 14 (SLC2A14), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A14 (144195)
Length:
3496
CDS:
201..1694

Additional Resources:

NCBI RefSeq record:
XM_024448849.1
NBCI Gene record:
SLC2A14 (144195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413155 CACTTTACTTTCTCTATTTCT pLKO_005 1157 CDS 100% 5.625 3.938 N SLC2A14 n/a
2 TRCN0000426334 CCGTCGGACTCTTTGTTAACC pLKO_005 442 CDS 100% 4.950 3.465 N SLC2A14 n/a
3 TRCN0000042882 GCTGGGCATAGTTATTGGAAT pLKO.1 680 CDS 100% 4.950 3.465 N SLC2A14 n/a
4 TRCN0000427763 TCACGAATCTCTGGTCCTTGT pLKO_005 379 CDS 100% 4.050 2.835 N SLC2A14 n/a
5 TRCN0000042878 CTATTAGGCTTTACCATCCTT pLKO.1 762 CDS 100% 3.000 2.100 N SLC2A14 n/a
6 TRCN0000042881 CCTGAGACGATCATAAAGGAA pLKO.1 303 CDS 100% 3.000 1.800 N SLC2A14 n/a
7 TRCN0000042879 CCAGGATGTATCCCAAGACAT pLKO.1 899 CDS 100% 4.950 2.475 Y SLC2A14 n/a
8 TRCN0000042880 CGGCTTCCTCATTACCTTCTT pLKO.1 1511 CDS 100% 4.950 2.475 Y SLC2A14 n/a
9 TRCN0000043617 CCCAGATCTTTGGTCTGGAAT pLKO.1 709 CDS 100% 0.495 0.248 Y SLC2A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13220 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13220 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477384 GCGCTAGGGCGTACATTGCGTGTA pLX_317 26.2% 100% 100% V5 n/a
4 ccsbBroadEn_01541 pDONR223 100% 96.5% 94.3% None (many diffs) n/a
5 ccsbBroad304_01541 pLX_304 0% 96.5% 94.3% V5 (many diffs) n/a
6 TRCN0000474012 TTTCATTGCGAGTACTGAATATAT pLX_317 30.6% 96.5% 94.3% V5 (many diffs) n/a
7 TRCN0000488592 ATCTCGTGGAGACGGGGACCTACA pLX_317 15.5% 96.3% 94.1% V5 (many diffs) n/a
8 TRCN0000487704 ATGTCTCCCTTTAGGTCTGCACAA pLX_317 16.1% 95.9% 94.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV