Transcript: Human XM_024448972.1

PREDICTED: Homo sapiens ADP ribosylation factor 3 (ARF3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARF3 (377)
Length:
3725
CDS:
437..982

Additional Resources:

NCBI RefSeq record:
XM_024448972.1
NBCI Gene record:
ARF3 (377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417301 ATGATGAGTCATTCCAATTTA pLKO_005 1185 3UTR 100% 15.000 21.000 N ARF3 n/a
2 TRCN0000420824 CAATGATCGGGAGCGAGTAAA pLKO_005 718 CDS 100% 13.200 18.480 N ARF3 n/a
3 TRCN0000047673 CGTCACCGTAACTGGTACATT pLKO.1 881 CDS 100% 5.625 7.875 N ARF3 n/a
4 TRCN0000414941 TGCTATGAACGCTGCTGAGAT pLKO_005 832 CDS 100% 4.950 6.930 N ARF3 n/a
5 TRCN0000438954 TGCATTCCCTTCGTCACCGTA pLKO_005 870 CDS 100% 2.640 3.696 N ARF3 n/a
6 TRCN0000047676 GAACACCCAAGGGTTGATATT pLKO.1 685 CDS 100% 13.200 9.240 N ARF3 n/a
7 TRCN0000439297 AGCCAGACAGCCCTAACAAAG pLKO_005 984 3UTR 100% 10.800 7.560 N ARF3 n/a
8 TRCN0000047677 CAAGAGCCTGATTGGGAAGAA pLKO.1 463 CDS 100% 4.950 3.465 N ARF3 n/a
9 TRCN0000047675 CATCCCTACCATTGGGTTCAA pLKO.1 571 CDS 100% 4.950 3.465 N ARF3 n/a
10 TRCN0000047674 GATGCTGTACTCCTTGTCTTT pLKO.1 788 CDS 100% 4.950 3.465 N ARF3 n/a
11 TRCN0000433130 TGATATTTGTGGTCGACAGCA pLKO_005 699 CDS 100% 2.640 1.848 N ARF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00095 pDONR223 100% 99.8% 100% None 117C>G n/a
2 ccsbBroad304_00095 pLX_304 0% 99.8% 100% V5 117C>G n/a
3 TRCN0000467892 AAGACCTTCCAAGGGGGGATCTAG pLX_317 85.4% 99.8% 100% V5 117C>G n/a
4 ccsbBroadEn_00094 pDONR223 100% 83.7% 96.1% None (many diffs) n/a
5 ccsbBroad304_00094 pLX_304 0% 83.7% 96.1% V5 (many diffs) n/a
6 TRCN0000470051 AGACATCCAACAGCAAGTTGGGTG pLX_317 77.4% 83.7% 96.1% V5 (many diffs) n/a
Download CSV