Transcript: Human XM_024449026.1

PREDICTED: Homo sapiens POU class 6 homeobox 1 (POU6F1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU6F1 (5463)
Length:
8223
CDS:
3071..4912

Additional Resources:

NCBI RefSeq record:
XM_024449026.1
NBCI Gene record:
POU6F1 (5463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310938 ATGCTCAGGGACAGGTTATTG pLKO_005 4032 CDS 100% 13.200 9.240 N Pou6f1 n/a
2 TRCN0000017970 CCTCTGCTCCTATCCCAATTA pLKO.1 4332 CDS 100% 13.200 9.240 N POU6F1 n/a
3 TRCN0000017969 CGGGAGTTTGCCAAGAACTTT pLKO.1 4448 CDS 100% 5.625 3.938 N POU6F1 n/a
4 TRCN0000017972 CCACAGTTCTGACAGGAGTTA pLKO.1 3459 CDS 100% 4.950 3.465 N POU6F1 n/a
5 TRCN0000017971 CTTCGCATTTAGCCCAGGAAT pLKO.1 3895 CDS 100% 4.950 3.465 N POU6F1 n/a
6 TRCN0000017968 CCCATCAGTATTGCAGGTCAA pLKO.1 3518 CDS 100% 4.050 2.835 N POU6F1 n/a
7 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 7019 3UTR 100% 13.200 6.600 Y IQCC n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 7117 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01248 pDONR223 100% 49.1% 48.9% None 1_930del;1322_1327delGCCTAG n/a
2 ccsbBroad304_01248 pLX_304 0% 49.1% 48.9% V5 1_930del;1322_1327delGCCTAG n/a
3 TRCN0000476325 GTCACTGTTAGTTGAGAACCACAG pLX_317 41.9% 49.1% 48.9% V5 1_930del;1322_1327delGCCTAG n/a
Download CSV