Transcript: Human XM_024449027.1

PREDICTED: Homo sapiens POU class 6 homeobox 1 (POU6F1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POU6F1 (5463)
Length:
6040
CDS:
1192..2397

Additional Resources:

NCBI RefSeq record:
XM_024449027.1
NBCI Gene record:
POU6F1 (5463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017970 CCTCTGCTCCTATCCCAATTA pLKO.1 2324 CDS 100% 13.200 9.240 N POU6F1 n/a
2 TRCN0000017972 CCACAGTTCTGACAGGAGTTA pLKO.1 1580 CDS 100% 4.950 3.465 N POU6F1 n/a
3 TRCN0000017971 CTTCGCATTTAGCCCAGGAAT pLKO.1 2016 CDS 100% 4.950 3.465 N POU6F1 n/a
4 TRCN0000017968 CCCATCAGTATTGCAGGTCAA pLKO.1 1639 CDS 100% 4.050 2.835 N POU6F1 n/a
5 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4836 3UTR 100% 13.200 6.600 Y IQCC n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4934 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449027.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01248 pDONR223 100% 22.1% 20.3% None (many diffs) n/a
2 ccsbBroad304_01248 pLX_304 0% 22.1% 20.3% V5 (many diffs) n/a
3 TRCN0000476325 GTCACTGTTAGTTGAGAACCACAG pLX_317 41.9% 22.1% 20.3% V5 (many diffs) n/a
Download CSV