Transcript: Human XM_024449114.1

PREDICTED: Homo sapiens retinoic acid receptor gamma (RARG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RARG (5916)
Length:
2567
CDS:
312..1460

Additional Resources:

NCBI RefSeq record:
XM_024449114.1
NBCI Gene record:
RARG (5916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021233 GCCTCCCTTAATCCGAGAGAT pLKO.1 1319 CDS 100% 4.950 6.930 N RARG n/a
2 TRCN0000021229 CCCTCAGTTAGAAGAGCTCAT pLKO.1 644 CDS 100% 4.050 5.670 N RARG n/a
3 TRCN0000236361 GTGCGAAATGACCGGAACAAG pLKO_005 573 CDS 100% 4.950 3.960 N RARG n/a
4 TRCN0000236364 CCCAGAGGAAGCCTCTATTTA pLKO_005 2282 3UTR 100% 15.000 10.500 N RARG n/a
5 TRCN0000244207 CAAAGCTGCCTGCCTAGATAT pLKO_005 884 CDS 100% 13.200 9.240 N RARG n/a
6 TRCN0000236363 GATGCTGGAGAACCCTGAAAT pLKO_005 1337 CDS 100% 13.200 9.240 N RARG n/a
7 TRCN0000021231 GCTGCGTATCTGCACAAGGTA pLKO.1 911 CDS 100% 3.000 2.100 N RARG n/a
8 TRCN0000021232 CAATGACAAGTCCTCTGGCTA pLKO.1 374 CDS 100% 2.640 1.848 N RARG n/a
9 TRCN0000236362 TCTGCCAGCTGGGCAAGTATA pLKO_005 706 CDS 100% 13.200 7.920 N RARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01377 pDONR223 100% 84.1% 84.1% None 0_1ins216 n/a
2 ccsbBroad304_01377 pLX_304 0% 84.1% 84.1% V5 0_1ins216 n/a
3 TRCN0000477930 AAATCGCTCGATATGCAACCGACA pLX_317 26.4% 84.1% 84.1% V5 0_1ins216 n/a
4 TRCN0000492180 GAGCGTTCAAATGCTATAAACGGT pLX_317 26.3% 84% 84.1% V5 (not translated due to prior stop codon) 0_1ins216;633G>A n/a
Download CSV