Transcript: Human XM_024449258.1

PREDICTED: Homo sapiens transmembrane protein 116 (TMEM116), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM116 (89894)
Length:
1563
CDS:
74..1240

Additional Resources:

NCBI RefSeq record:
XM_024449258.1
NBCI Gene record:
TMEM116 (89894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129879 GATACCCAGACACCATTATTA pLKO.1 1133 CDS 100% 15.000 21.000 N TMEM116 n/a
2 TRCN0000148405 CCCAGCTGTCATTCTAATGAT pLKO.1 955 CDS 100% 5.625 7.875 N TMEM116 n/a
3 TRCN0000150034 CGCTAATGGATTGGAAAGAAT pLKO.1 1281 3UTR 100% 5.625 7.875 N TMEM116 n/a
4 TRCN0000146926 CCTTACCATTATGGTCTTACT pLKO.1 802 CDS 100% 4.950 6.930 N TMEM116 n/a
5 TRCN0000150148 GCACAAATTCCACCAACTAAA pLKO.1 1090 CDS 100% 13.200 10.560 N TMEM116 n/a
6 TRCN0000148988 GAGCCACAAGTGTATCTTGAT pLKO.1 667 CDS 100% 4.950 3.960 N TMEM116 n/a
7 TRCN0000130648 CCGAGCCCAGACATTGTATAA pLKO.1 826 CDS 100% 13.200 9.240 N TMEM116 n/a
8 TRCN0000129859 GCTATTGATGACACCTGTATT pLKO.1 604 CDS 100% 13.200 9.240 N TMEM116 n/a
9 TRCN0000150262 GCTCACAGAAGAGATTCTATA pLKO.1 1155 CDS 100% 13.200 9.240 N TMEM116 n/a
10 TRCN0000148387 CTGCCAGTACTTCTACCATTT pLKO.1 1215 CDS 100% 10.800 7.560 N TMEM116 n/a
11 TRCN0000146925 CTGGAGTTATTCTACGCTAAT pLKO.1 1267 3UTR 100% 10.800 7.560 N TMEM116 n/a
12 TRCN0000149424 CTCTCCAGTTATTCCCAGATT pLKO.1 1408 3UTR 100% 4.950 3.465 N TMEM116 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09283 pDONR223 100% 63% 63.1% None 1_429del;858A>G n/a
2 ccsbBroad304_09283 pLX_304 0% 63% 63.1% V5 1_429del;858A>G n/a
3 TRCN0000466848 TGTGACATTCTCACTGCCAGTGTG pLX_317 57.3% 63% 63.1% V5 1_429del;858A>G n/a
4 ccsbBroadEn_12927 pDONR223 100% 53.8% 53.8% None 1_537del n/a
5 ccsbBroad304_12927 pLX_304 0% 53.8% 53.8% V5 1_537del n/a
6 TRCN0000491502 TCGTACGAGGCGCGCACCTTGTCA pLX_317 52.8% 53.8% 53.8% V5 1_537del n/a
Download CSV