Transcript: Human XM_024449334.1

PREDICTED: Homo sapiens spartin (SPART), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPART (23111)
Length:
5134
CDS:
413..2413

Additional Resources:

NCBI RefSeq record:
XM_024449334.1
NBCI Gene record:
SPART (23111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310781 TTGGCGTAACTGCCTACAATA pLKO_005 2202 CDS 100% 13.200 18.480 N SPART n/a
2 TRCN0000084035 GCAAGTAGTGTTCAAGGATTT pLKO.1 2039 CDS 100% 10.800 8.640 N SPART n/a
3 TRCN0000300007 GCAAGTAGTGTTCAAGGATTT pLKO_005 2039 CDS 100% 10.800 8.640 N SPART n/a
4 TRCN0000084034 CCCAAGTTATATCCAGAATTT pLKO.1 743 CDS 100% 13.200 9.240 N SPART n/a
5 TRCN0000084033 GCCTTATGAAATGGATGAAAT pLKO.1 2442 3UTR 100% 13.200 9.240 N SPART n/a
6 TRCN0000300009 GCCTTATGAAATGGATGAAAT pLKO_005 2442 3UTR 100% 13.200 9.240 N SPART n/a
7 TRCN0000084037 CTATGGTTGTAGCAGCAAGTA pLKO.1 2025 CDS 100% 4.950 3.465 N SPART n/a
8 TRCN0000300010 CTATGGTTGTAGCAGCAAGTA pLKO_005 2025 CDS 100% 4.950 3.465 N SPART n/a
9 TRCN0000084036 GCTAGACAGATGCAACAGAAA pLKO.1 632 CDS 100% 4.950 3.465 N SPART n/a
10 TRCN0000300008 GCTAGACAGATGCAACAGAAA pLKO_005 632 CDS 100% 4.950 3.465 N SPART n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07839 pDONR223 100% 99.8% 99.6% None 205C>A;1250C>A;1629A>G n/a
2 ccsbBroad304_07839 pLX_304 0% 99.8% 99.6% V5 205C>A;1250C>A;1629A>G n/a
3 TRCN0000478689 GTTCCGTTCACCGACTGAGGGTAG pLX_317 9.7% 99.8% 99.6% V5 205C>A;1250C>A;1629A>G n/a
Download CSV