Transcript: Human XM_024449381.1

PREDICTED: Homo sapiens ankyrin repeat domain 10 (ANKRD10), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD10 (55608)
Length:
6814
CDS:
138..656

Additional Resources:

NCBI RefSeq record:
XM_024449381.1
NBCI Gene record:
ANKRD10 (55608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437658 ACCGGATTGTGAGGGTGAAAC pLKO_005 497 CDS 100% 10.800 8.640 N ANKRD10 n/a
2 TRCN0000426369 AGAATGCATCAGTGCCCTTGT pLKO_005 551 CDS 100% 4.050 2.835 N ANKRD10 n/a
3 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2250 3UTR 100% 4.950 2.475 Y ERAP2 n/a
4 TRCN0000085280 CGGCAAGTTGGAGTGCTTAAT pLKO.1 341 CDS 100% 13.200 10.560 N Ankrd10 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2251 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5945 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5945 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449381.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12232 pDONR223 100% 76.4% 69.6% None (many diffs) n/a
2 ccsbBroad304_12232 pLX_304 0% 76.4% 69.6% V5 (many diffs) n/a
3 TRCN0000471743 GTACTTGCGGGATATGTGTTGCAG pLX_317 68.6% 76.4% 69.6% V5 (many diffs) n/a
Download CSV